|
|
| GeneID |
79596
|
| Symbol |
RNF219
|
| Synonyms |
C13orf7|DKFZp686A01276|DKFZp686N15250|DKFZp686O03173|FLJ13449|FLJ25774
|
| Description |
ring finger protein 219 |
| See related |
HGNC:20308|Ensembl:ENSG00000152193|HPRD:12619| |
| Locus tag |
- |
| Gene type |
protein-coding |
| Map location |
13q31.1 |
|
| |
|
|
| Gene set name |
Method of gene set |
Evidence |
Info |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia] | Click to show detail |
|
| |
| General Gene Expression (microarray) ? |
|
 |
| |
| Gene Expression in Brain Regions (new) |
|
| |
| Top co-expressed genes in Brain Regions (new) |
|
| Gene | Pearson's Correlation | Spearman's Correlation | | |
| Top 10 positively co-expressed genes |
Top 10 negatively co-expressed genes | |
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0005515 | protein binding | IEA | | - |
| GO:0008270 | zinc ion binding | IEA | | - |
| GO:0046872 | metal ion binding | IEA | | - |
| |
|
|
| |
|
| miR-218 | 1097 | 1104 | 1A,m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|