|
|
| GeneID |
79711
|
| Symbol |
IPO4
|
| Synonyms |
FLJ23338|Imp4|MGC131665
|
| Description |
importin 4 |
| See related |
HGNC:19426|Ensembl:ENSG00000196497|HPRD:07022| |
| Locus tag |
- |
| Gene type |
protein-coding |
| Map location |
14q12 |
|
| |
|
|
| Gene set name |
Method of gene set |
Evidence |
Info |
| GSMA_I | genome scan meta-analysis | Psr: 0.047 | |
|
| |
| General Gene Expression (microarray) ? |
|
 |
| |
| Gene Expression in Brain Regions (new) |
|
| |
| Top co-expressed genes in Brain Regions (new) |
|
| Gene | Pearson's Correlation | Spearman's Correlation | | |
| Top 10 positively co-expressed genes |
| AQP9 | 0.38 | 0.35 | | |
| PLA2G4A | 0.38 | 0.40 | | |
| ANO1 | 0.38 | 0.43 | | |
| PDE4C | 0.38 | 0.38 | | |
| SERPINE2 | 0.37 | 0.44 | | |
| PAH | 0.37 | 0.39 | | |
| HSPB3 | 0.37 | 0.38 | | |
| CMTM8 | 0.36 | 0.36 | | |
| ABCG5 | 0.36 | 0.30 | | |
| C12orf64 | 0.36 | 0.40 | | |
Top 10 negatively co-expressed genes | | RBMX2 | -0.30 | -0.31 | | |
| UPF3B | -0.29 | -0.28 | | |
| PSMC3IP | -0.28 | -0.26 | | |
| BAZ1A | -0.28 | -0.32 | | |
| LEMD1 | -0.28 | -0.28 | | |
| SOX11 | -0.28 | -0.24 | | |
| CCDC123 | -0.28 | -0.20 | | |
| CBX8 | -0.27 | -0.24 | | |
| PDE9A | -0.27 | -0.29 | | |
| ZNF695 | -0.27 | -0.24 | | |
|
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0004623 | phospholipase A2 activity | IEA | | - |
| GO:0005488 | binding | IEA | | - |
| GO:0005515 | protein binding | IPI | | 17353931 |
| GO:0008565 | protein transporter activity | IEA | | - |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0000059 | protein import into nucleus, docking | IEA | | - |
| GO:0016042 | lipid catabolic process | IEA | | - |
| GO:0006644 | phospholipid metabolic process | IEA | | - |
| GO:0006886 | intracellular protein transport | IEA | | - |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0005634 | nucleus | IEA | | - |
| GO:0005643 | nuclear pore | NAS | | 11823430 |
| GO:0005737 | cytoplasm | IEA | | - |
| |
|
|
| |
|
| miR-9 | 83 | 90 | 1A,m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|