Gene Page: ASAM

Summary
GeneID  79827
Symbol  ASAM
Synonyms  ACAM|CLMP|FLJ22415
Description  adipocyte-specific adhesion molecule
See related  MIM:611693|Ensembl:ENSG00000166250|HPRD:16513|
Locus tag  -
Gene type  protein-coding
Map location  11q24.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.006 
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005923tight junctionIEABrain (GO term level: 10)-
GO:0005634nucleusIDA18029348 
GO:0005737cytoplasmIDA18029348 
GO:0016021integral to membraneIEA-
GO:0005886plasma membraneIEA-
GO:0030054cell junctionIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124/506217223m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-1387682m8hsa-miR-138brainAGCUGGUGUUGUGAAUC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.