SZGR2

Summary ?

GeneID	79856
Symbol	SNX22
Synonyms	-
Description	sorting nexin 22
Reference	HGNC:HGNC:16315\|Ensembl:ENSG00000157734\|HPRD:15412\|Vega:OTTHUMG00000132965
Gene type	protein-coding
Map location	15q22.31
Pascal p-value	0.002
Fetal beta	-1.348
DMG	1 (# studies)

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
Expression	Meta-analysis of gene expression	P value: 1.804

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg01556457	15	64443744	SNX22	3.345E-4	-0.421	0.041	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
DYNC2LI1	0.61	0.62
MED10	0.60	0.61
ACTR10	0.59	0.63
EBNA1BP2	0.59	0.61
ARPC3	0.59	0.62
UBE2B	0.58	0.62
ARPC4	0.58	0.59
SPATA7	0.58	0.62
GGPS1	0.58	0.61
FARSB	0.57	0.59

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.8	-0.53	-0.47
AF347015.2	-0.52	-0.47
AF347015.26	-0.51	-0.46
AF347015.15	-0.51	-0.47
MT-CO2	-0.50	-0.45
MT-CYB	-0.50	-0.47
AF347015.27	-0.49	-0.46
AF347015.18	-0.49	-0.45
MT-ATP8	-0.48	-0.44
AF347015.33	-0.48	-0.45

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IEA		-
GO:0035091	phosphoinositide binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007154	cell communication	IEA		-
GO:0015031	protein transport	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
WANG LMO4 TARGETS DN	352	225	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP	1821	933	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN	537	339	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2	491	319	All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE DN	841	431	All SZGR 2.0 genes in this pathway
STAMBOLSKY TARGETS OF MUTATED TP53 UP	49	35	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION UP	570	339	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-146	2363	2370	1A,m8	hsa-miR-146a	UGAGAACUGAAUUCCAUGGGUU
miR-146	2363	2370	1A,m8	hsa-miR-146b^brain	UGAGAACUGAAUUCCAUAGGCU
miR-23	1394	1400	m8	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
miR-23	1394	1400	m8	hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-31	1553	1559	m8	hsa-miR-31	AGGCAAGAUGCUGGCAUAGCUG
miR-323	1394	1400	1A	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: SNX22