Gene Page: C10orf119

Summary
GeneID  79892
Symbol  C10orf119
Synonyms  FLJ13081|FLJ36756|MCM-BP|MCMBP
Description  chromosome 10 open reading frame 119
See related  HGNC:25782|MIM:610909|Ensembl:ENSG00000197771|HPRD:07624|
Locus tag  -
Gene type  protein-coding
Map location  10q26.11
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 1.351 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003674molecular_functionND-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0008150biological_processND-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005575cellular_componentND-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
DDIT3CEBPZ | CHOP | CHOP10 | GADD153 | MGC4154DNA-damage-inducible transcript 3Two-hybridBioGRID16189514 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-182682688m8hsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-496140014061Ahsa-miR-496AUUACAUGGCCAAUCUC
miR-504129513021A,m8hsa-miR-504AGACCCUGGUCUGCACUCUAU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.