Gene Page: ATAT1
Summary ?
GeneID | 79969 |
Symbol | ATAT1 |
Synonyms | C6orf134|MEC17|Nbla00487|TAT|alpha-TAT|alpha-TAT1 |
Description | alpha tubulin acetyltransferase 1 |
Reference | MIM:615556|HGNC:HGNC:21186|Ensembl:ENSG00000137343|HPRD:12850|Vega:OTTHUMG00000031219 |
Gene type | protein-coding |
Map location | 6p21.33 |
Pascal p-value | 2.209E-14 |
Sherlock p-value | 0.655 |
Fetal beta | 2.009 |
eGene | Frontal Cortex BA9 Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs17795337 | chr6 | 136492658 | ATAT1 | 79969 | 0.15 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN | 335 | 193 | All SZGR 2.0 genes in this pathway |
MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN | 164 | 111 | All SZGR 2.0 genes in this pathway |
TONG INTERACT WITH PTTG1 | 57 | 32 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA C D DN | 252 | 155 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA CHEMOTAXIS DN | 457 | 302 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA PCA1 UP | 101 | 66 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA PRONEURAL | 177 | 132 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D | 882 | 506 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-141/200a | 1582 | 1588 | m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
miR-150 | 1530 | 1536 | m8 | hsa-miR-150 | UCUCCCAACCCUUGUACCAGUG |
miR-182 | 1121 | 1128 | 1A,m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-185 | 451 | 457 | m8 | hsa-miR-185brain | UGGAGAGAAAGGCAGUUC |
miR-218 | 852 | 858 | m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
miR-342 | 1354 | 1360 | 1A | hsa-miR-342brain | UCUCACACAGAAAUCGCACCCGUC |
miR-96 | 1122 | 1128 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.