Gene Page: C10orf88

Summary
GeneID  80007
Symbol  C10orf88
Synonyms  FLJ13490
Description  chromosome 10 open reading frame 88
See related  HGNC:25822|Ensembl:ENSG00000119965|HPRD:18531|
Locus tag  -
Gene type  protein-coding
Map location  10q26.13
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.03487 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005524ATP bindingIEA-
GO:0016887ATPase activityIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CLTCCHC | CHC17 | CLH-17 | CLTCL2 | Hc | KIAA0034clathrin, heavy chain (Hc)Two-hybridBioGRID16169070 
IMMTDKFZp779P1653 | HMP | MGC111146 | P87 | P87/89 | P89 | PIG4 | PIG52inner membrane protein, mitochondrial (mitofilin)Two-hybridBioGRID16169070 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-485-3p3613671Ahsa-miR-485-3pGUCAUACACGGCUCUCCUCUCU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.