Gene Page: UXS1

Summary
GeneID  80146
Symbol  UXS1
Synonyms  FLJ23591|UGD
Description  UDP-glucuronate decarboxylase 1
See related  HGNC:17729|MIM:609749|Ensembl:ENSG00000115652|HPRD:15642|
Locus tag  -
Gene type  protein-coding
Map location  2q12.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0004 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00755 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005488bindingIEA-
GO:0016829lyase activityIEA-
GO:0048040UDP-glucuronate decarboxylase activityIEA-
GO:0050662coenzyme bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0044237cellular metabolic processIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005794Golgi apparatusIEA-
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
AKT1AKT | MGC99656 | PKB | PKB-ALPHA | PRKBA | RAC | RAC-ALPHAv-akt murine thymoma viral oncogene homolog 1-HPRD11877387 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1451111181A,m8hsa-miR-145GUCCAGUUUUCCCAGGAAUCCCUU
miR-153406412m8hsa-miR-153UUGCAUAGUCACAAAAGUGA
miR-30-3p3283341Ahsa-miR-30a-3pCUUUCAGUCGGAUGUUUGCAGC
hsa-miR-30e-3pCUUUCAGUCGGAUGUUUACAGC
miR-3751061121Ahsa-miR-375UUUGUUCGUUCGGCUCGCGUGA
miR-433-3p991051Ahsa-miR-433brainAUCAUGAUGGGCUCCUCGGUGU
miR-452545551m8hsa-miR-452UGUUUGCAGAGGAAACUGAGAC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.