Gene Page: BPIFB2
Summary ?
GeneID | 80341 |
Symbol | BPIFB2 |
Synonyms | BPIL1|C20orf184|LPLUNC2|RYSR|dJ726C3.2 |
Description | BPI fold containing family B member 2 |
Reference | MIM:614108|HGNC:HGNC:16177|Ensembl:ENSG00000078898|HPRD:10690|Vega:OTTHUMG00000032232 |
Gene type | protein-coding |
Map location | 20q11.21 |
Pascal p-value | 0.027 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
DDR1 | 0.82 | 0.84 |
AL161668.2 | 0.82 | 0.84 |
PARD3 | 0.81 | 0.74 |
SPATA13 | 0.80 | 0.73 |
SALL2 | 0.80 | 0.83 |
PALLD | 0.80 | 0.75 |
ERBB2 | 0.79 | 0.77 |
DNMBP | 0.79 | 0.66 |
AC130686.2 | 0.78 | 0.76 |
TSPAN11 | 0.78 | 0.80 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
C5orf53 | -0.45 | -0.52 |
CA4 | -0.44 | -0.51 |
AF347015.31 | -0.44 | -0.54 |
CA11 | -0.42 | -0.51 |
HSPB3 | -0.42 | -0.55 |
RERGL | -0.42 | -0.62 |
CXCL14 | -0.41 | -0.54 |
KRT17 | -0.41 | -0.61 |
MYL3 | -0.41 | -0.54 |
AF347015.27 | -0.41 | -0.49 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0008289 | lipid binding | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005576 | extracellular region | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
RICKMAN HEAD AND NECK CANCER D | 37 | 14 | All SZGR 2.0 genes in this pathway |
STONER ESOPHAGEAL CARCINOGENESIS UP | 39 | 25 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS LATE PROGENITOR | 544 | 307 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-335 | 307 | 313 | 1A | hsa-miR-335brain | UCAAGAGCAAUAACGAAAAAUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.