|
|
| GeneID |
80704
|
| Symbol |
SLC19A3
|
| Synonyms |
THTR2
|
| Description |
solute carrier family 19, member 3 |
| See related |
HGNC:16266|MIM:606152|Ensembl:ENSG00000135917|HPRD:07311| |
| Locus tag |
- |
| Gene type |
protein-coding |
| Map location |
2q37 |
|
| |
|
|
| Gene set name |
Method of gene set |
Evidence |
Info |
| GSMA_IIA | genome scan meta-analysis (All samples) | Psr: 0.00916 | | | GSMA_IIE | genome scan meta-analysis (European-ancestry samples) | Psr: 0.01016 | |
|
| |
| General Gene Expression (microarray) ? |
|
 |
| |
| Gene Expression in Brain Regions (new) |
|
| |
| Top co-expressed genes in Brain Regions (new) |
|
| Gene | Pearson's Correlation | Spearman's Correlation | | |
| Top 10 positively co-expressed genes |
Top 10 negatively co-expressed genes | |
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0005542 | folic acid binding | IEA | | - |
| GO:0008518 | reduced folate carrier activity | IEA | | - |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0006810 | transport | NAS | | - |
| GO:0042723 | thiamin and derivative metabolic process | EXP | | 3060175 |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0016020 | membrane | IEA | | - |
| GO:0016021 | integral to membrane | NAS | | 11136550 |
| |
|
| miR-140 | 130 | 137 | 1A,m8 | hsa-miR-140brain | AGUGGUUUUACCCUAUGGUAG |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|
