Gene Page: PTP4A2

Summary
GeneID  8073
Symbol  PTP4A2
Synonyms  HH13|HH7-2|HU-PP-1|OV-1|PRL-2|PRL2|PTP4A|PTPCAAX2|ptp-IV1a|ptp-IV1b
Description  protein tyrosine phosphatase type IVA, member 2
See related  HGNC:9635|MIM:601584|Ensembl:ENSG00000184007|HPRD:03348|
Locus tag  -
Gene type  protein-coding
Map location  1p35
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 1.526 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI17353931 
GO:0004727prenylated protein tyrosine phosphatase activityTAS9514946 
GO:0016787hydrolase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006470protein amino acid dephosphorylationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIEA-
GO:0005769early endosomeIEA-
GO:0005886plasma membraneIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CNNM3ACDP3 | DKFZp434I1016 | FLJ20018cyclin M3Affinity Capture-MSBioGRID17353931 
CNNM4ACDP4 | FLJ42791 | KIAA1592cyclin M4Affinity Capture-MSBioGRID17353931 
FNTAFPTA | MGC99680 | PGGT1A | PTAR2farnesyltransferase, CAAX box, alphaAffinity Capture-MSBioGRID17353931 
FNTBFPTB | MGC31935farnesyltransferase, CAAX box, betaAffinity Capture-MSBioGRID17353931 
PTP4A1DKFZp779M0721 | HH72 | PRL-1 | PRL1 | PTP(CAAX1) | PTPCAAX1protein tyrosine phosphatase type IVA, member 1Affinity Capture-MSBioGRID17353931 
RABGGTBGGTBRab geranylgeranyltransferase, beta subunit-HPRD,BioGRID11447212 
TNFAIP8GG2-1 | MDC-3.13 | SCC-S2 | SCCS2tumor necrosis factor, alpha-induced protein 8Affinity Capture-MSBioGRID17353931 
USF2FIP | bHLHb12upstream transcription factor 2, c-fos interactingAffinity Capture-MSBioGRID17353931 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-48870761Ahsa-miR-488CCCAGAUAAUGGCACUCUCAA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.