Gene Page: THSD7B
Summary ?
| GeneID | 80731 |
| Symbol | THSD7B |
| Synonyms | - |
| Description | thrombospondin type 1 domain containing 7B |
| Reference | HGNC:HGNC:29348|Ensembl:ENSG00000144229|Vega:OTTHUMG00000153590 |
| Gene type | protein-coding |
| Map location | 2q22.1 |
| Pascal p-value | 0.117 |
| Fetal beta | 2.505 |
| eGene | Cerebellar Hemisphere Cerebellum |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.023 | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.02395 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| KCNJ12 | 0.75 | 0.69 |
| ADRA1D | 0.74 | 0.83 |
| GPR26 | 0.71 | 0.78 |
| ADARB2 | 0.70 | 0.59 |
| ANKRD34C | 0.70 | 0.73 |
| KCNC2 | 0.70 | 0.70 |
| KCNH5 | 0.70 | 0.46 |
| GLRA3 | 0.69 | 0.66 |
| RASGRF1 | 0.68 | 0.76 |
| RASSF5 | 0.68 | 0.75 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| RBMX2 | -0.31 | -0.51 |
| KIAA1949 | -0.31 | -0.34 |
| TUBB2B | -0.30 | -0.43 |
| AF186192.1 | -0.30 | -0.38 |
| CARHSP1 | -0.30 | -0.50 |
| RPS6 | -0.30 | -0.46 |
| ZNF435 | -0.30 | -0.37 |
| TXNIP | -0.30 | -0.36 |
| C14orf93 | -0.30 | -0.41 |
| GPR125 | -0.30 | -0.33 |
Section III. Gene Ontology annotation
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| MEISSNER NPC HCP WITH H3 UNMETHYLATED | 536 | 296 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF HCP WITH H3 UNMETHYLATED | 228 | 119 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124.1 | 33 | 40 | 1A,m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
| miR-124/506 | 33 | 39 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| miR-183 | 1056 | 1062 | m8 | hsa-miR-183 | UAUGGCACUGGUAGAAUUCACUG |
| miR-203.1 | 529 | 535 | 1A | hsa-miR-203 | UGAAAUGUUUAGGACCACUAG |
| miR-219 | 335 | 341 | m8 | hsa-miR-219brain | UGAUUGUCCAAACGCAAUUCU |
| miR-30-3p | 241 | 247 | 1A | hsa-miR-30a-3p | CUUUCAGUCGGAUGUUUGCAGC |
| hsa-miR-30e-3p | CUUUCAGUCGGAUGUUUACAGC | ||||
| miR-329 | 207 | 213 | m8 | hsa-miR-329brain | AACACACCUGGUUAACCUCUUU |
| miR-331 | 584 | 591 | 1A,m8 | hsa-miR-331brain | GCCCCUGGGCCUAUCCUAGAA |
| miR-433-3p | 503 | 509 | 1A | hsa-miR-433brain | AUCAUGAUGGGCUCCUCGGUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.