Gene Page: GPR63
Summary ?
GeneID | 81491 |
Symbol | GPR63 |
Synonyms | PSP24(beta)|PSP24B |
Description | G protein-coupled receptor 63 |
Reference | MIM:606915|HGNC:HGNC:13302|Ensembl:ENSG00000112218|HPRD:06076|Vega:OTTHUMG00000015245 |
Gene type | protein-coding |
Map location | 6q16.1-q16.3 |
Pascal p-value | 0.012 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
A2M | 0.87 | 0.87 |
HLA-E | 0.81 | 0.84 |
ABCB1 | 0.81 | 0.83 |
SEMA3G | 0.81 | 0.83 |
PGM5 | 0.80 | 0.82 |
SLCO2B1 | 0.79 | 0.81 |
MMRN2 | 0.79 | 0.79 |
ABCG2 | 0.78 | 0.78 |
TGM2 | 0.78 | 0.83 |
LSR | 0.78 | 0.79 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
ZNF433 | -0.63 | -0.62 |
RP9 | -0.61 | -0.62 |
POLG2 | -0.61 | -0.60 |
ZNF311 | -0.60 | -0.51 |
CCAR1 | -0.60 | -0.62 |
FRG1 | -0.60 | -0.65 |
ZNF300 | -0.59 | -0.52 |
DNAJC2 | -0.59 | -0.61 |
UPF3B | -0.59 | -0.54 |
CYP2R1 | -0.59 | -0.61 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004872 | receptor activity | IEA | - | |
GO:0003674 | molecular_function | ND | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007186 | G-protein coupled receptor protein signaling pathway | IEA | - | |
GO:0007165 | signal transduction | IEA | - | |
GO:0008150 | biological_process | ND | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0016021 | integral to membrane | IEA | - | |
GO:0005886 | plasma membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
ROVERSI GLIOMA COPY NUMBER DN | 54 | 37 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA CD1 UP | 45 | 29 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA CD1 VS CD2 UP | 66 | 47 | All SZGR 2.0 genes in this pathway |
LEIN CEREBELLUM MARKERS | 85 | 47 | All SZGR 2.0 genes in this pathway |
BONCI TARGETS OF MIR15A AND MIR16 1 | 91 | 75 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-15/16/195/424/497 | 342 | 349 | 1A,m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
hsa-miR-497 | CAGCAGCACACUGUGGUUUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.