Gene Page: CAPN1

Summary
GeneID  823
Symbol  CAPN1
Synonyms  CANP|CANP1|CANPL1|muCANP|muCL
Description  calpain 1, (mu/I) large subunit
See related  HGNC:1476|MIM:114220|HPRD:00253|
Locus tag  -
Gene type  protein-coding
Map location  11q13
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.25 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005509calcium ion bindingIEA-
GO:0005515protein bindingIPI15935327 
GO:0004198calcium-dependent cysteine-type endopeptidase activityIEA-
GO:0008233peptidase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006508proteolysisIEA-
GO:0008284positive regulation of cell proliferationTAS8702541 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIEA-
GO:0005737cytoplasmIEA-
GO:0005886plasma membraneIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ACTC1ACTC | CMD1R | CMH11actin, alpha, cardiac muscle 1CAPN1 interacts with ACTC.BIND12358155 
ACTN2CMD1AAactinin, alpha 2CAPN1 interacts with ACTN2.BIND12358155 
BIDFP497 | MGC15319 | MGC42355BH3 interacting domain death agonist-HPRD12000759 
C11orf59FLJ20625chromosome 11 open reading frame 59CAPN1 interacts with FLJ20625.BIND12358155 
CAPNS130K | CALPAIN4 | CANP | CANPS | CAPN4 | CDPScalpain, small subunit 1-HPRD12591934 
CAPN1 interacts with CAPNS1.BIND12358155 
CASTBS-17 | MGC9402calpastatin-HPRD,BioGRID12684003 
COL1A1OI4collagen, type I, alpha 1CAPN1 interacts with COL1A1.BIND12358155 
COL3A1EDS4A | FLJ34534collagen, type III, alpha 1CAPN1 interacts with COL3A1.BIND12358155 
CREG1CREGcellular repressor of E1A-stimulated genes 1CAPN1 interacts with CREG1.BIND12358155 
CTSCCPPI | DPP1 | DPPI | HMS | JP | JPD | PALS | PLScathepsin CCAPN1 interacts with CTSC.BIND12358155 
DESCMD1I | CSM1 | CSM2 | FLJ12025 | FLJ39719 | FLJ41013 | FLJ41793desminCAPN1 interacts with DES.BIND12358155 
ECHS1SCEHenoyl Coenzyme A hydratase, short chain, 1, mitochondrialCAPN1 interacts with ECHS1.BIND12358155 
FHL2AAG11 | DRAL | SLIM3four and a half LIM domains 2CAPN1 interacts with FHL2.BIND12358155 
GPTAAT1 | ALT1 | GPT1glutamic-pyruvate transaminase (alanine aminotransferase)CAPN1 interacts with GPT.BIND12358155 
INPP4AINPP4inositol polyphosphate-4-phosphatase, type I, 107kDa-HPRD9110986 
KNG1BDK | KNGkininogen 1-HPRD3038169 |8253784 
MYBPC3CMH4 | DKFZp779E1762 | FHC | MYBP-Cmyosin binding protein C, cardiacCAPN1 interacts with MYBPC3.BIND12358155 
NFE2L1FLJ00380 | LCR-F1 | NRF1 | TCF11nuclear factor (erythroid-derived 2)-like 1CAPN1 interacts with NFE2L1.BIND12358155 
NFKBIAIKBA | MAD-3 | NFKBInuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha-HPRD,BioGRID10521480 
PRMT5HRMT1L5 | IBP72 | JBP1 | SKB1 | SKB1Hsprotein arginine methyltransferase 5CAPN1 interacts with SKB1.BIND12358155 
PSEN2AD3L | AD4 | PS2 | STM2presenilin 2 (Alzheimer disease 4)-HPRD,BioGRID9852298 
PTGDSLPGDS | PDS | PGD2 | PGDS | PGDS2prostaglandin D2 synthase 21kDa (brain)CAPN1 interacts with PTGDS.BIND12358155 
SH3BGR21-GARPSH3 domain binding glutamic acid-rich proteinCAPN1 interacts with SH3BGR.BIND12358155 
SLIT3FLJ10764 | MEGF5 | SLIL2 | SLIT1 | Slit-3 | slit2slit homolog 3 (Drosophila)CAPN1 interacts with SLIT3.BIND12358155 
SYNE18B | CPG2 | DKFZp781J13156 | FLJ30878 | FLJ41140 | KIAA0796 | KIAA1262 | KIAA1756 | MYNE1 | SCAR8spectrin repeat containing, nuclear envelope 1CAPN1 interacts with SYNE1.BIND12358155 
TINAGL1ARG1 | LCN7 | LIECG3 | TINAGRPtubulointerstitial nephritis antigen-like 1CAPN1 interacts with LCN7.BIND12358155 
UFSP2C4orf20 | FLJ11200UFM1-specific peptidase 2CAPN1 interacts with FLJ11200.BIND12358155 
VIMFLJ36605vimentinCAPN1 interacts with VIM.BIND12358155 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124/50695101m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.