Gene Page: GFI1B

Summary
GeneID  8328
Symbol  GFI1B
Synonyms  -
Description  growth factor independent 1B transcription repressor
See related  HGNC:4238|MIM:604383|Ensembl:ENSG00000165702|HPRD:05088|
Locus tag  RP11-415H23.1
Gene type  protein-coding
Map location  9q34.13
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0143 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003677DNA bindingIEA-
GO:0003704specific RNA polymerase II transcription factor activityTAS9566867 
GO:0005515protein bindingIPI16713569 
GO:0008270zinc ion bindingIEA-
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0000114regulation of transcription during G1 phase of mitotic cell cycleTAS9566867 
GO:0000122negative regulation of transcription from RNA polymerase II promoterTAS9566867 
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0006350transcriptionIEA-
GO:0008283cell proliferationTAS9566867 
GO:0007275multicellular organismal developmentIEA-
GO:0016568chromatin modificationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIEA-
GO:0005634nucleusIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-485-5p59661A,m8hsa-miR-485-5pAGAGGCUGGCCGUGAUGAAUUC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.