Gene Page: RAB6C
Summary ?
| GeneID | 84084 |
| Symbol | RAB6C |
| Synonyms | WTH3 |
| Description | RAB6C, member RAS oncogene family |
| Reference | MIM:612909|HGNC:HGNC:16525|Ensembl:ENSG00000222014|HPRD:15201|Vega:OTTHUMG00000153487 |
| Gene type | protein-coding |
| Map location | 2q21.1 |
| Pascal p-value | 0.631 |
| Sherlock p-value | 0.265 |
| Fetal beta | -0.876 |
| DMG | 1 (# studies) |
| eGene | Caudate basal ganglia Hippocampus Putamen basal ganglia Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| GSMA_I | Genome scan meta-analysis | Psr: 0.023 | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00755 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg25181900 | 2 | 130738053 | RAB6C | 4.811E-4 | -0.449 | 0.046 | DMG:Wockner_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs4491879 | chr3 | 189373908 | RAB6C | 84084 | 0.04 | trans | ||
| rs4505678 | chr3 | 189374356 | RAB6C | 84084 | 0.06 | trans | ||
| rs12327665 | chr19 | 39622639 | RAB6C | 84084 | 0.12 | trans | ||
| rs6760544 | 2 | 130694072 | RAB6C | ENSG00000222014.4 | 1.063E-9 | 0 | -43163 | gtex_brain_putamen_basal |
| rs397945442 | 2 | 130694101 | RAB6C | ENSG00000222014.4 | 5.593E-9 | 0 | -43134 | gtex_brain_putamen_basal |
| rs1882608 | 2 | 130695820 | RAB6C | ENSG00000222014.4 | 5.234E-9 | 0 | -41415 | gtex_brain_putamen_basal |
| rs4619549 | 2 | 130697710 | RAB6C | ENSG00000222014.4 | 1.739E-8 | 0 | -39525 | gtex_brain_putamen_basal |
| rs11679667 | 2 | 130698516 | RAB6C | ENSG00000222014.4 | 5.313E-8 | 0 | -38719 | gtex_brain_putamen_basal |
| rs1922633 | 2 | 130701189 | RAB6C | ENSG00000222014.4 | 4.646E-9 | 0 | -36046 | gtex_brain_putamen_basal |
| rs1922632 | 2 | 130705665 | RAB6C | ENSG00000222014.4 | 4.567E-10 | 0 | -31570 | gtex_brain_putamen_basal |
| rs6737432 | 2 | 130707020 | RAB6C | ENSG00000222014.4 | 1.784E-7 | 0 | -30215 | gtex_brain_putamen_basal |
| rs2178727 | 2 | 130710764 | RAB6C | ENSG00000222014.4 | 3.735E-10 | 0 | -26471 | gtex_brain_putamen_basal |
| rs78599069 | 2 | 130711523 | RAB6C | ENSG00000222014.4 | 4.265E-10 | 0 | -25712 | gtex_brain_putamen_basal |
| rs4600594 | 2 | 130711564 | RAB6C | ENSG00000222014.4 | 3.681E-10 | 0 | -25671 | gtex_brain_putamen_basal |
| rs4550621 | 2 | 130711746 | RAB6C | ENSG00000222014.4 | 1.662E-6 | 0 | -25489 | gtex_brain_putamen_basal |
| rs4600595 | 2 | 130711784 | RAB6C | ENSG00000222014.4 | 1.657E-6 | 0 | -25451 | gtex_brain_putamen_basal |
| rs4359586 | 2 | 130711846 | RAB6C | ENSG00000222014.4 | 3.654E-10 | 0 | -25389 | gtex_brain_putamen_basal |
| rs201584462 | 2 | 130713109 | RAB6C | ENSG00000222014.4 | 5.494E-7 | 0 | -24126 | gtex_brain_putamen_basal |
| rs12468461 | 2 | 130713396 | RAB6C | ENSG00000222014.4 | 1.072E-9 | 0 | -23839 | gtex_brain_putamen_basal |
| rs12468499 | 2 | 130713455 | RAB6C | ENSG00000222014.4 | 7.238E-10 | 0 | -23780 | gtex_brain_putamen_basal |
| rs10803610 | 2 | 130714237 | RAB6C | ENSG00000222014.4 | 7.441E-7 | 0 | -22998 | gtex_brain_putamen_basal |
| rs10803611 | 2 | 130714261 | RAB6C | ENSG00000222014.4 | 1.899E-6 | 0 | -22974 | gtex_brain_putamen_basal |
| rs10803612 | 2 | 130714328 | RAB6C | ENSG00000222014.4 | 3.144E-8 | 0 | -22907 | gtex_brain_putamen_basal |
| rs13417834 | 2 | 130714574 | RAB6C | ENSG00000222014.4 | 2.35E-7 | 0 | -22661 | gtex_brain_putamen_basal |
| rs7581114 | 2 | 130715510 | RAB6C | ENSG00000222014.4 | 1.046E-9 | 0 | -21725 | gtex_brain_putamen_basal |
| rs6757615 | 2 | 130718086 | RAB6C | ENSG00000222014.4 | 1.166E-9 | 0 | -19149 | gtex_brain_putamen_basal |
| rs7604709 | 2 | 130719738 | RAB6C | ENSG00000222014.4 | 1.403E-7 | 0 | -17497 | gtex_brain_putamen_basal |
| rs35275119 | 2 | 130721571 | RAB6C | ENSG00000222014.4 | 1.547E-9 | 0 | -15664 | gtex_brain_putamen_basal |
| rs11675216 | 2 | 130722438 | RAB6C | ENSG00000222014.4 | 1.414E-9 | 0 | -14797 | gtex_brain_putamen_basal |
| rs13395676 | 2 | 130724786 | RAB6C | ENSG00000222014.4 | 6.486E-9 | 0 | -12449 | gtex_brain_putamen_basal |
| rs6709481 | 2 | 130730457 | RAB6C | ENSG00000222014.4 | 2.146E-9 | 0 | -6778 | gtex_brain_putamen_basal |
| rs4662673 | 2 | 130731298 | RAB6C | ENSG00000222014.4 | 5.364E-7 | 0 | -5937 | gtex_brain_putamen_basal |
| rs10928946 | 2 | 130733087 | RAB6C | ENSG00000222014.4 | 3.889E-10 | 0 | -4148 | gtex_brain_putamen_basal |
| rs6431124 | 2 | 130733324 | RAB6C | ENSG00000222014.4 | 7.978E-8 | 0 | -3911 | gtex_brain_putamen_basal |
| rs9808290 | 2 | 130734194 | RAB6C | ENSG00000222014.4 | 3.8E-7 | 0 | -3041 | gtex_brain_putamen_basal |
| rs4347768 | 2 | 130737541 | RAB6C | ENSG00000222014.4 | 4.051E-10 | 0 | 306 | gtex_brain_putamen_basal |
| rs4233601 | 2 | 130737578 | RAB6C | ENSG00000222014.4 | 1.112E-8 | 0 | 343 | gtex_brain_putamen_basal |
| rs55993213 | 2 | 130739646 | RAB6C | ENSG00000222014.4 | 3.694E-9 | 0 | 2411 | gtex_brain_putamen_basal |
| rs11674996 | 2 | 130739891 | RAB6C | ENSG00000222014.4 | 1.076E-9 | 0 | 2656 | gtex_brain_putamen_basal |
| rs10084226 | 2 | 130781397 | RAB6C | ENSG00000222014.4 | 1.972E-6 | 0 | 44162 | gtex_brain_putamen_basal |
| rs4405700 | 2 | 130793095 | RAB6C | ENSG00000222014.4 | 3.427E-6 | 0 | 55860 | gtex_brain_putamen_basal |
| rs10165978 | 2 | 130795485 | RAB6C | ENSG00000222014.4 | 3.561E-6 | 0 | 58250 | gtex_brain_putamen_basal |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0003924 | GTPase activity | IDA | 10455022 | |
| GO:0005525 | GTP binding | IEA | - | |
| GO:0005216 | ion channel activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006811 | ion transport | IEA | - | |
| GO:0007264 | small GTPase mediated signal transduction | TAS | 10455022 | |
| GO:0042493 | response to drug | IDA | 11054569 | |
| GO:0015031 | protein transport | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005622 | intracellular | IC | 10455022 | |
| GO:0016020 | membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
| BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
| BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
| GEORGES TARGETS OF MIR192 AND MIR215 | 893 | 528 | All SZGR 2.0 genes in this pathway |
| GABRIELY MIR21 TARGETS | 289 | 187 | All SZGR 2.0 genes in this pathway |
| KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
| ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF | 516 | 308 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124.1 | 1121 | 1127 | m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
| miR-124/506 | 1121 | 1127 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| miR-21 | 1218 | 1224 | 1A | hsa-miR-21brain | UAGCUUAUCAGACUGAUGUUGA |
| hsa-miR-590 | GAGCUUAUUCAUAAAAGUGCAG | ||||
| miR-216 | 1401 | 1407 | m8 | hsa-miR-216 | UAAUCUCAGCUGGCAACUGUG |
| miR-218 | 15 | 22 | 1A,m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
| miR-299-3p | 1717 | 1724 | 1A,m8 | hsa-miR-299-3p | UAUGUGGGAUGGUAAACCGCUU |
| miR-324-3p | 476 | 482 | m8 | hsa-miR-324-3p | CCACUGCCCCAGGUGCUGCUGG |
| miR-342 | 1399 | 1405 | 1A | hsa-miR-342brain | UCUCACACAGAAAUCGCACCCGUC |
| miR-543 | 135 | 141 | 1A | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
| miR-93.hd/291-3p/294/295/302/372/373/520 | 1666 | 1672 | m8 | hsa-miR-93brain | AAAGUGCUGUUCGUGCAGGUAG |
| hsa-miR-302a | UAAGUGCUUCCAUGUUUUGGUGA | ||||
| hsa-miR-302b | UAAGUGCUUCCAUGUUUUAGUAG | ||||
| hsa-miR-302c | UAAGUGCUUCCAUGUUUCAGUGG | ||||
| hsa-miR-302d | UAAGUGCUUCCAUGUUUGAGUGU | ||||
| hsa-miR-372 | AAAGUGCUGCGACAUUUGAGCGU | ||||
| hsa-miR-373 | GAAGUGCUUCGAUUUUGGGGUGU | ||||
| hsa-miR-520e | AAAGUGCUUCCUUUUUGAGGG | ||||
| hsa-miR-520a | AAAGUGCUUCCCUUUGGACUGU | ||||
| hsa-miR-520b | AAAGUGCUUCCUUUUAGAGGG | ||||
| hsa-miR-520c | AAAGUGCUUCCUUUUAGAGGGUU | ||||
| hsa-miR-520d | AAAGUGCUUCUCUUUGGUGGGUU | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.