Gene Page: FBXO30
Summary ?
| GeneID | 84085 |
| Symbol | FBXO30 |
| Synonyms | Fbx30 |
| Description | F-box protein 30 |
| Reference | MIM:609101|HGNC:HGNC:15600|HPRD:10953| |
| Gene type | protein-coding |
| Map location | 6q24 |
| Pascal p-value | 0.937 |
| Sherlock p-value | 0.79 |
| Fetal beta | 0.83 |
| DMG | 2 (# studies) |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 2 |
| DMG:vanEijk_2014 | Genome-wide DNA methylation analysis | This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250). | 2 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg12831148 | 6 | 146136093 | FBXO30 | 7.4E-11 | -0.011 | 4.34E-7 | DMG:Jaffe_2016 |
| cg12130692 | 6 | 146057073 | FBXO30 | 0.003 | -1.926 | DMG:vanEijk_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs2023879 | chr7 | 51038201 | FBXO30 | 84085 | 0.16 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006511 | ubiquitin-dependent protein catabolic process | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS MAGENTA UP | 28 | 18 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
| COLDREN GEFITINIB RESISTANCE UP | 85 | 57 | All SZGR 2.0 genes in this pathway |
| LIM MAMMARY STEM CELL UP | 489 | 314 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| let-7/98 | 799 | 805 | 1A | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
| hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
| hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
| hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
| hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
| hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
| hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
| hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
| hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
| miR-124.1 | 173 | 180 | 1A,m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
| miR-124/506 | 173 | 179 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| miR-128 | 1550 | 1556 | 1A | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
| hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
| miR-142-5p | 64 | 70 | m8 | hsa-miR-142-5p | CAUAAAGUAGAAAGCACUAC |
| miR-183 | 440 | 446 | 1A | hsa-miR-183 | UAUGGCACUGGUAGAAUUCACUG |
| miR-27 | 1550 | 1556 | m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
| hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
| miR-34/449 | 437 | 444 | 1A,m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
| hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
| hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
| hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
| miR-377 | 190 | 197 | 1A,m8 | hsa-miR-377 | AUCACACAAAGGCAACUUUUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.