Gene Page: TOMM40L
Summary ?
| GeneID | 84134 |
| Symbol | TOMM40L |
| Synonyms | TOMM40B |
| Description | translocase of outer mitochondrial membrane 40 like |
| Reference | HGNC:HGNC:25756|Ensembl:ENSG00000158882|HPRD:13354|Vega:OTTHUMG00000034345 |
| Gene type | protein-coding |
| Map location | 1q23.3 |
| Sherlock p-value | 0.045 |
| Support | Ascano FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00814 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003677 | DNA binding | IEA | - | |
| GO:0005515 | protein binding | IEA | - | |
| GO:0008308 | voltage-gated anion channel activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006820 | anion transport | IEA | - | |
| GO:0016481 | negative regulation of transcription | IEA | - | |
| GO:0015031 | protein transport | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005829 | cytosol | IEA | - | |
| GO:0005634 | nucleus | IEA | - | |
| GO:0005739 | mitochondrion | IEA | - | |
| GO:0005741 | mitochondrial outer membrane | IEA | - | |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - | |
| GO:0043234 | protein complex | IDA | 11256614 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG AMYOTROPHIC LATERAL SCLEROSIS ALS | 53 | 43 | All SZGR 2.0 genes in this pathway |
| BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
| STARK PREFRONTAL CORTEX 22Q11 DELETION DN | 517 | 309 | All SZGR 2.0 genes in this pathway |
| MASSARWEH TAMOXIFEN RESISTANCE UP | 578 | 341 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN ES ICP WITH H3K4ME3 | 718 | 401 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN NPC ICP WITH H3K4ME3 | 445 | 257 | All SZGR 2.0 genes in this pathway |
| ZWANG EGF INTERVAL DN | 214 | 124 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-346 | 735 | 742 | 1A,m8 | hsa-miR-346brain | UGUCUGCCCGCAUGCCUGCCUCU |
| miR-378 | 1438 | 1444 | 1A | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.