Gene Page: PPP1R1B
Summary ?
| GeneID | 84152 |
| Symbol | PPP1R1B |
| Synonyms | DARPP-32|DARPP32 |
| Description | protein phosphatase 1 regulatory inhibitor subunit 1B |
| Reference | MIM:604399|HGNC:HGNC:9287|Ensembl:ENSG00000131771|HPRD:05097|Vega:OTTHUMG00000133210 |
| Gene type | protein-coding |
| Map location | 17q12 |
| Pascal p-value | 8.688E-4 |
| Sherlock p-value | 0.97 |
| Fetal beta | -0.397 |
| DMG | 1 (# studies) |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Association | A combined odds ratio method (Sun et al. 2008), association studies | 1 | Link to SZGene |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg22834172 | 17 | 37774349 | PPP1R1B | 2.92E-9 | -0.013 | 2.05E-6 | DMG:Jaffe_2016 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs7098073 | chr10 | 108641448 | PPP1R1B | 84152 | 0.14 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004864 | protein phosphatase inhibitor activity | TAS | 10604473 | |
| GO:0004860 | protein kinase inhibitor activity | TAS | 10604473 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006350 | transcription | IEA | - | |
| GO:0007165 | signal transduction | TAS | 10604473 | |
| GO:0007621 | negative regulation of female receptivity | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005737 | cytoplasm | NAS | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| BIOCARTA CK1 PATHWAY | 17 | 17 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
| REACTOME OPIOID SIGNALLING | 78 | 56 | All SZGR 2.0 genes in this pathway |
| REACTOME DARPP 32 EVENTS | 25 | 20 | All SZGR 2.0 genes in this pathway |
| BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER DN | 169 | 118 | All SZGR 2.0 genes in this pathway |
| TAKEDA TARGETS OF NUP98 HOXA9 FUSION 8D DN | 205 | 127 | All SZGR 2.0 genes in this pathway |
| TAKEDA TARGETS OF NUP98 HOXA9 FUSION 10D DN | 142 | 90 | All SZGR 2.0 genes in this pathway |
| JOHANSSON GLIOMAGENESIS BY PDGFB DN | 21 | 16 | All SZGR 2.0 genes in this pathway |
| MANTOVANI NFKB TARGETS UP | 43 | 33 | All SZGR 2.0 genes in this pathway |
| MANTOVANI VIRAL GPCR SIGNALING UP | 86 | 54 | All SZGR 2.0 genes in this pathway |
| STARK PREFRONTAL CORTEX 22Q11 DELETION UP | 195 | 138 | All SZGR 2.0 genes in this pathway |
| NIKOLSKY BREAST CANCER 17Q11 Q21 AMPLICON | 133 | 78 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
| LU EZH2 TARGETS UP | 295 | 155 | All SZGR 2.0 genes in this pathway |
| PURBEY TARGETS OF CTBP1 NOT SATB1 DN | 448 | 282 | All SZGR 2.0 genes in this pathway |
| JUBAN TARGETS OF SPI1 AND FLI1 UP | 115 | 73 | All SZGR 2.0 genes in this pathway |
| ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL UP | 289 | 184 | All SZGR 2.0 genes in this pathway |
| LIM MAMMARY STEM CELL DN | 428 | 246 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-330 | 600 | 607 | 1A,m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.