Gene Page: ASCC2

Summary
GeneID  84164
Symbol  ASCC2
Synonyms  ASC1p100
Description  activating signal cointegrator 1 complex subunit 2
See related  HGNC:24103|Ensembl:ENSG00000100325|HPRD:16515|
Locus tag  SC22CB-11B7.2
Gene type  protein-coding
Map location  22q12.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.031 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0006350transcriptionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIDA18029348 
GO:0005737cytoplasmIDA18029348 
GO:0005925focal adhesionIDA18029348 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
AOF2BHC110 | KDM1 | KIAA0601 | LSD1amine oxidase (flavin containing) domain 2Two-hybridBioGRID16169070 
ASCC3ASC1p200 | DJ467N11.1 | HELIC1 | MGC26074 | RNAH | dJ121G13.4activating signal cointegrator 1 complex subunit 3-HPRD12077347 
ASS1ASS | CTLN1argininosuccinate synthetase 1Two-hybridBioGRID16169070 
CKAP4CLIMP-63 | ERGIC-63 | MGC99554 | p63cytoskeleton-associated protein 4Two-hybridBioGRID16169070 
CUTCCGI-32 | RP11-483F11.3cutC copper transporter homolog (E. coli)Two-hybridBioGRID16169070 
DEAF1NUDR | SPN | ZMYND5deformed epidermal autoregulatory factor 1 (Drosophila)Two-hybridBioGRID16169070 
EEF1DEF-1D | EF1D | FLJ20897 | FP1047eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)Two-hybridBioGRID16169070 
ELAC2ELC2 | FLJ10530 | FLJ36693 | FLJ42848 | HPC2elaC homolog 2 (E. coli)Two-hybridBioGRID16169070 
ESR1DKFZp686N23123 | ER | ESR | ESRA | Era | NR3A1estrogen receptor 1ER interacts with ASC1p100.BIND16009131 
FAF1CGI-03 | FLJ37524 | HFAF1s | UBXD12 | UBXN3A | hFAF1Fas (TNFRSF6) associated factor 1Two-hybridBioGRID16169070 
FBP1FBPfructose-1,6-bisphosphatase 1Two-hybridBioGRID16169070 
FUNDC2DC44 | FLJ33773 | HCBP6 | HCC3 | MGC131676 | MGC2495 | PD03104FUN14 domain containing 2Two-hybridBioGRID16169070 
GFERALR | ERV1 | HERV1 | HPO | HPO1 | HPO2 | HSSgrowth factor, augmenter of liver regenerationTwo-hybridBioGRID16169070 
GNL3C77032 | E2IG3 | MGC800 | NSguanine nucleotide binding protein-like 3 (nucleolar)Two-hybridBioGRID16169070 
GTF3C1DKFZp686A111 | TFIIIC | TFIIIC220 | TFIIICalphageneral transcription factor IIIC, polypeptide 1, alpha 220kDaTwo-hybridBioGRID16169070 
IGSF9FP18798 | IGSF9A | KIAA1355 | Nrt1immunoglobulin superfamily, member 9Two-hybridBioGRID16169070 
IMMTDKFZp779P1653 | HMP | MGC111146 | P87 | P87/89 | P89 | PIG4 | PIG52inner membrane protein, mitochondrial (mitofilin)Two-hybridBioGRID16169070 
JUNAP-1 | AP1 | c-Junjun oncogeneReconstituted Complex
Two-hybrid
BioGRID12077347 
LPLHDLCQ11 | LIPDlipoprotein lipaseTwo-hybridBioGRID16169070 
MED313110004H13Rik | CGI-125 | FLJ27436 | FLJ36714 | Soh1mediator complex subunit 31Two-hybridBioGRID16169070 
MYH9DFNA17 | EPSTS | FTNS | MGC104539 | MHA | NMHC-II-A | NMMHCAmyosin, heavy chain 9, non-muscleTwo-hybridBioGRID16169070 
OLA1DKFZp313H1942 | GTPBP9 | PTD004Obg-like ATPase 1Two-hybridBioGRID16169070 
PIK3CDp110Dphosphoinositide-3-kinase, catalytic, delta polypeptideTwo-hybridBioGRID16169070 
PIN4EPVH | MGC138486 | PAR14 | PAR17protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)Two-hybridBioGRID16169070 
PJA1RNF70praja 1Two-hybridBioGRID16169070 
POLA2FLJ21662 | FLJ37250polymerase (DNA directed), alpha 2 (70kD subunit)Two-hybridBioGRID16169070 
POLDIP2DKFZp586F1524 | PDIP38 | POLD4polymerase (DNA-directed), delta interacting protein 2Two-hybridBioGRID16169070 
RADILFLJ10324 | KIAA1849 | MGC161589Rap GTPase interactorTwo-hybridBioGRID16169070 
RELAMGC131774 | NFKB3 | p65v-rel reticuloendotheliosis viral oncogene homolog A (avian)Reconstituted Complex
Two-hybrid
BioGRID12077347 
RPA1HSSB | REPA1 | RF-A | RP-A | RPA70replication protein A1, 70kDaTwo-hybridBioGRID16169070 
RPLP1FLJ27448 | MGC5215 | P1 | RPP1ribosomal protein, large, P1Two-hybridBioGRID16169070 
SNRPBCOD | SNRPB1 | SmB/SmB' | snRNP-Bsmall nuclear ribonucleoprotein polypeptides B and B1Two-hybridBioGRID16169070 
SNW1Bx42 | MGC119379 | NCOA-62 | PRPF45 | Prp45 | SKIIP | SKIPSNW domain containing 1Two-hybridBioGRID16169070 
SRFMCM1serum response factor (c-fos serum response element-binding transcription factor)Reconstituted Complex
Two-hybrid
BioGRID12077347 
TBC1D17FLJ12168TBC1 domain family, member 17Two-hybridBioGRID16169070 
TRIP4HsT17391thyroid hormone receptor interactor 4-HPRD12077347 
URM1C9orf74 | MGC2668ubiquitin related modifier 1 homolog (S. cerevisiae)Two-hybridBioGRID16169070 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124.1190196m8hsa-miR-124aUUAAGGCACGCGGUGAAUGCCA
miR-124/5061891961A,m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.