Gene Page: CHD6
Summary ?
| GeneID | 84181 |
| Symbol | CHD6 |
| Synonyms | CHD-6|CHD5|RIGB |
| Description | chromodomain helicase DNA binding protein 6 |
| Reference | MIM:616114|HGNC:HGNC:19057|Ensembl:ENSG00000124177|HPRD:13049|Vega:OTTHUMG00000032487 |
| Gene type | protein-coding |
| Map location | 20q12 |
| Pascal p-value | 0.127 |
| Sherlock p-value | 0.59 |
| Fetal beta | 0.503 |
| DMG | 1 (# studies) |
| eGene | Myers' cis & trans |
| Support | CompositeSet Darnell FMRP targets Ascano FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg21545849 | 20 | 40247209 | CHD6 | 1.55E-10 | -0.011 | 5E-7 | DMG:Jaffe_2016 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs7084863 | chr10 | 6753797 | CHD6 | 84181 | 0.06 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0003677 | DNA binding | IEA | - | |
| GO:0003682 | chromatin binding | NAS | 12592387 | |
| GO:0005524 | ATP binding | IEA | - | |
| GO:0016787 | hydrolase activity | IEA | - | |
| GO:0008026 | ATP-dependent helicase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007399 | nervous system development | NAS | neurite (GO term level: 5) | 12592387 |
| GO:0006333 | chromatin assembly or disassembly | IEA | - | |
| GO:0006355 | regulation of transcription, DNA-dependent | NAS | 12592387 | |
| GO:0006350 | transcription | IEA | - | |
| GO:0006338 | chromatin remodeling | NAS | 12592387 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000785 | chromatin | IEA | - | |
| GO:0005634 | nucleus | NAS | 12592387 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| XU GH1 AUTOCRINE TARGETS DN | 142 | 94 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 6HR UP | 953 | 554 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 24HR UP | 783 | 442 | All SZGR 2.0 genes in this pathway |
| YOSHIMURA MAPK8 TARGETS DN | 366 | 257 | All SZGR 2.0 genes in this pathway |
| VANTVEER BREAST CANCER ESR1 UP | 167 | 99 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
| ABRAMSON INTERACT WITH AIRE | 45 | 33 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-143 | 1562 | 1568 | 1A | hsa-miR-143brain | UGAGAUGAAGCACUGUAGCUCA |
| miR-194 | 1425 | 1432 | 1A,m8 | hsa-miR-194 | UGUAACAGCAACUCCAUGUGGA |
| miR-26 | 1296 | 1302 | 1A | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
| hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
| miR-496 | 1543 | 1549 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
| miR-504 | 162 | 168 | m8 | hsa-miR-504 | AGACCCUGGUCUGCACUCUAU |
| miR-543 | 1548 | 1554 | 1A | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.