Gene Page: TRAF7

Summary
GeneID  84231
Symbol  TRAF7
Synonyms  DKFZp586I021|MGC7807|RFWD1|RNF119
Description  TNF receptor-associated factor 7
See related  HGNC:20456|MIM:606692|Ensembl:ENSG00000131653|HPRD:06977|
Locus tag  -
Gene type  protein-coding
Map location  16p13.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005509calcium ion bindingIEA-
GO:0004842ubiquitin-protein ligase activityIDA14743216 
GO:0016874ligase activityIEA-
GO:0008270zinc ion bindingNAS14743216 
GO:0042802identical protein bindingIPI14743216 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007269neurotransmitter secretionIEAneuron, axon, Synap, serotonin, Neurotransmitter, dopamine (GO term level: 8)-
GO:0000185activation of MAPKKK activityIDA14743216 
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0006350transcriptionIEA-
GO:0006511ubiquitin-dependent protein catabolic processIEA-
GO:0016567protein ubiquitinationIDA14743216 
GO:0042981regulation of apoptosisIMP15001576 
GO:0043410positive regulation of MAPKKK cascadeIDA15001576 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0043005neuron projectionIEAneuron, axon, neurite, dendrite (GO term level: 5)-
GO:0000151ubiquitin ligase complexIDA14743216 
GO:0048471perinuclear region of cytoplasmIEA-
GO:0031410cytoplasmic vesicleIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
MAP3K3MAPKKK3 | MEKK3mitogen-activated protein kinase kinase kinase 3TRAF7 interacts with an unspecified isoform of MAP3K3 (MEKK3).BIND14743216 
Affinity Capture-MSBioGRID14743216 
TRAF7DKFZp586I021 | MGC7807 | RFWD1 | RNF119TNF receptor-associated factor 7TRAF7 interacts with TRAF7.BIND14743216 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-245935991Ahsa-miR-24SZUGGCUCAGUUCAGCAGGAACAG
miR-32013851391m8hsa-miR-320AAAAGCUGGGUUGAGAGGGCGAA
miR-324-3p130136m8hsa-miR-324-3pCCACUGCCCCAGGUGCUGCUGG
miR-346136313701A,m8hsa-miR-346brainUGUCUGCCCGCAUGCCUGCCUCU
miR-4528969021Ahsa-miR-452UGUUUGCAGAGGAAACUGAGAC
miR-495147414801Ahsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.