Gene Page: AKT1S1

Summary
GeneID  84335
Symbol  AKT1S1
Synonyms  Lobe|MGC2865|PRAS40
Description  AKT1 substrate 1 (proline-rich)
See related  HGNC:28426|MIM:610221|Ensembl:ENSG00000204673|HPRD:12441|
Locus tag  -
Gene type  protein-coding
Map location  19q13.33
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0043526neuroprotectionISSneuron (GO term level: 9)-
GO:0045884regulation of survival gene product expressionISS-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIEA-
GO:0044445cytosolic partISS-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
EIF62 | CAB | EIF3A | ITGB4BP | b | b(2)gcn | gcn | p27BBPeukaryotic translation initiation factor 6Two-hybridBioGRID16169070 
TCEA2TFIIStranscription elongation factor A (SII), 2Two-hybridBioGRID16169070 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124.17357421A,m8hsa-miR-124aUUAAGGCACGCGGUGAAUGCCA
miR-124/5067347411A,m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-142-3p534540m8hsa-miR-142-3pUGUAGUGUUUCCUACUUUAUGGA
miR-2168488551A,m8hsa-miR-216UAAUCUCAGCUGGCAACUGUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.