|
|
| GeneID |
84418
|
| Symbol |
C5orf32
|
| Synonyms |
ORF1-FL49
|
| Description |
chromosome 5 open reading frame 32 |
| See related |
HGNC:30239|Ensembl:ENSG00000120306|HPRD:15091| |
| Locus tag |
- |
| Gene type |
protein-coding |
| Map location |
5q31.3 |
|
| |
|
|
| Gene set name |
Method of gene set |
Evidence |
Info |
| GSMA_I | genome scan meta-analysis | Psr: 0.0032 | |
|
| |
| General Gene Expression (microarray) ? |
|
 |
| |
| Gene Expression in Brain Regions (new) |
|
| |
| Top co-expressed genes in Brain Regions (new) |
|
| Gene | Pearson's Correlation | Spearman's Correlation | | |
| Top 10 positively co-expressed genes |
Top 10 negatively co-expressed genes | |
| miR-494 | 350 | 357 | 1A,m8 | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|
