Gene Page: BTBD12

Summary
GeneID  84464
Symbol  BTBD12
Synonyms  KIAA1784|KIAA1987
Description  BTB (POZ) domain containing 12
See related  HGNC:23845|Ensembl:ENSG00000188827|HPRD:12537|
Locus tag  -
Gene type  protein-coding
Map location  16p13.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 1.91 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1389059111Ahsa-miR-138brainAGCUGGUGUUGUGAAUC
miR-25/32/92/363/367113211391A,m8hsa-miR-25brainCAUUGCACUUGUCUCGGUCUGA
hsa-miR-32UAUUGCACAUUACUAAGUUGC
hsa-miR-92UAUUGCACUUGUCCCGGCCUG
hsa-miR-367AAUUGCACUUUAGCAAUGGUGA
hsa-miR-92bSZUAUUGCACUCGUCCCGGCCUC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.