Summary ?
GeneID85358
SymbolSHANK3
SynonymsDEL22q13.3|PROSAP2|PSAP2|SCZD15|SPANK-2
DescriptionSH3 and multiple ankyrin repeat domains 3
ReferenceMIM:606230|HGNC:HGNC:14294|Ensembl:ENSG00000251322|
Gene typeprotein-coding
Map location22q13.3
Pascal p-value0.03
Fetal beta-0.71
DMG1 (# studies)
SupportPROTEIN CLUSTERING
G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS
G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL
G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS
G2Cdb.humanPSD
G2Cdb.humanPSP
CompositeSet
Darnell FMRP targets
Potential synaptic genes

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Wockner_2014Genome-wide DNA methylation analysisThis dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
DNM:Awadalla_2010Whole Exome Sequencing analysisA survey of ~430 Mb of DNA from 401 synapse-expressed genes across all cases and 25 Mb of DNA in controls found 28 candidate DNMs.
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophreniasClick to show details
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 

Section I. Genetics and epigenetics annotation

@DNM table

GeneChromosomePositionRefAltTranscriptAA changeMutation typeSiftCG46TraitStudy
SHANK3chr2251137225CTSHANK3:NM_033517:exon12:c.C1564T:p.R522WR536Wnonsynonymous SNVChildhood-onset SchizophreniaDNM:Awadalla_2010
SHANK3chr2251159610CTSHANK3:NM_033517:exon21:c.C3307T:p.R1103XR1117XstopgainSchizoaffective mild mental retardationDNM:Awadalla_2010

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg262018112251111714SHANK35.959E-40.8350.05DMG:Wockner_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIEA-
GO:0017124SH3 domain bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0000165MAPKKK cascadeIEA-
GO:0001838embryonic epithelial tube formationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0045211postsynaptic membraneIEASynap, Neurotransmitter (GO term level: 5)-
GO:0045202synapseIEAneuron, Synap, Neurotransmitter, Glial (GO term level: 2)-
GO:0005737cytoplasmIEA-
GO:0005886plasma membraneIEA-
GO:0030054cell junctionIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
PID RET PATHWAY 3929All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER EARLY UP 430232All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL UP 316190All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN 1375806All SZGR 2.0 genes in this pathway
PEREZ TP63 TARGETS 355243All SZGR 2.0 genes in this pathway
PEREZ TP53 AND TP63 TARGETS 205145All SZGR 2.0 genes in this pathway
BILD E2F3 ONCOGENIC SIGNATURE 246153All SZGR 2.0 genes in this pathway
MELLMAN TUT1 TARGETS DN 4729All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE 721492All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION UP 271165All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1017121718m8hsa-miR-10aUACCCUGUAGAUCCGAAUUUGUG
hsa-miR-10bUACCCUGUAGAACCGAAUUUGU
miR-128133013371A,m8hsa-miR-128aUCACAGUGAACCGGUCUCUUUU
hsa-miR-128bUCACAGUGAACCGGUCUCUUUC
miR-214719725m8hsa-miR-214brainACAGCAGGCACAGACAGGCAG
miR-2713311337m8hsa-miR-27abrainUUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrainUUCACAGUGGCUAAGUUCUGC
miR-299-3p164416501Ahsa-miR-299-3pUAUGUGGGAUGGUAAACCGCUU
miR-33115061512m8hsa-miR-331brainGCCCCUGGGCCUAUCCUAGAA
miR-34/4495435501A,m8hsa-miR-34abrainUGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34cAGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449bAGGCAGUGUAUUGUUAGCUGGC
hsa-miR-34abrainUGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34cAGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449bAGGCAGUGUAUUGUUAGCUGGC
hsa-miR-34abrainUGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34cAGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449bAGGCAGUGUAUUGUUAGCUGGC
miR-369-3p186118671Ahsa-miR-369-3pAAUAAUACAUGGUUGAUCUUU
miR-374186118681A,m8hsa-miR-374UUAUAAUACAACCUGAUAAGUG
miR-3754494551Ahsa-miR-375UUUGUUCGUUCGGCUCGCGUGA
miR-376c18261832m8hsa-miR-376cAACAUAGAGGAAAUUCCACG
miR-378331337m8hsa-miR-378CUCCUGACUCCAGGUCCUGUGU
miR-491181518211Ahsa-miR-491brainAGUGGGGAACCCUUCCAUGAGGA
miR-49418291835m8hsa-miR-494brainUGAAACAUACACGGGAAACCUCUU
miR-504171317201A,m8hsa-miR-504AGACCCUGGUCUGCACUCUAU
miR-543106112m8hsa-miR-543AAACAUUCGCGGUGCACUUCU
miR-75235301A,m8hsa-miR-7SZUGGAAGACUAGUGAUUUUGUUG