Gene Page: MYLK2

Summary
GeneID  85366
Symbol  MYLK2
Synonyms  KMLC|MLCK|MLCK2|skMLCK
Description  myosin light chain kinase 2
See related  HGNC:16243|MIM:606566|Ensembl:ENSG00000101306|HPRD:05953|
Locus tag  -
Gene type  protein-coding
Map location  20q13.31
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0005516calmodulin bindingIEA-
GO:0005524ATP bindingIEA-
GO:0004683calmodulin-dependent protein kinase activityISS-
GO:0004687myosin light chain kinase activityIEA-
GO:0016740transferase activityIEA-
GO:0032027myosin light chain bindingIC16448786 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007274neuromuscular synaptic transmissionIEAneuron, Synap (GO term level: 7)-
GO:0055008cardiac muscle morphogenesisIMP16448786 
GO:0006468protein amino acid phosphorylationIEA-
GO:0032971regulation of muscle filament slidingIDA16448786 
GO:0060048cardiac muscle contractionIC16448786 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIEA-
GO:0030017sarcomereIC16448786 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124/506859865m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-3425155211Ahsa-miR-342brainUCUCACACAGAAAUCGCACCCGUC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.