SZGR2

Summary ?

GeneID	85406
Symbol	DNAJC14
Synonyms	DNAJ\|DRIP78\|HDJ3\|LIP6
Description	DnaJ heat shock protein family (Hsp40) member C14
Reference	MIM:606092\|HGNC:HGNC:24581\|Ensembl:ENSG00000135392\|HPRD:12082\|Vega:OTTHUMG00000170427
Gene type	protein-coding
Map location	12q13.2
Pascal p-value	0.646
Sherlock p-value	0.011
Fetal beta	0.377
DMG	1 (# studies)
eGene	Meta

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.2

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg10897533	12	56223504	DNAJC14	1.48E-10	-0.013	5E-7	DMG:Jaffe_2016

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0031072	heat shock protein binding	IEA		-
GO:0051082	unfolded protein binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006457	protein folding	IEA		-
GO:0015031	protein transport	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005789	endoplasmic reticulum membrane	IEA		-
GO:0005783	endoplasmic reticulum	IEA		-
GO:0016020	membrane	IEA		-
GO:0016021	integral to membrane	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
DODD NASOPHARYNGEAL CARCINOMA DN	1375	806	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN	770	415	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER UP	973	570	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP	863	514	All SZGR 2.0 genes in this pathway
PEDRIOLI MIR31 TARGETS DN	418	245	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-125/351	28	34	1A	hsa-miR-125b^brain	UCCCUGAGACCCUAACUUGUGA
miR-125/351	28	34	1A	hsa-miR-125a^brain	UCCCUGAGACCCUUUAACCUGUG
miR-221/222	596	602	m8	hsa-miR-221^brain	AGCUACAUUGUCUGCUGGGUUUC
miR-221/222	596	602	m8	hsa-miR-222^brain	AGCUACAUCUGGCUACUGGGUCUC
miR-495	832	838	m8	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-9	344	351	1A,m8	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: DNAJC14