SZGR2

Summary ?

GeneID	8573
Symbol	CASK
Synonyms	CAGH39\|CAMGUK\|CMG\|FGS4\|LIN2\|MICPCH\|MRXSNA\|TNRC8
Description	calcium/calmodulin-dependent serine protein kinase (MAGUK family)
Reference	MIM:300172\|HGNC:HGNC:1497\|Ensembl:ENSG00000147044\|HPRD:02164\|Vega:OTTHUMG00000021378
Gene type	protein-coding
Map location	Xp11.4
Fetal beta	1.432
Support	PROTEIN CLUSTERING G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS Ascano FMRP targets Potential synaptic genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Expression	Meta-analysis of gene expression	P value: 1.461
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.1861

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
KIAA1305	0.97	0.95
PLXNB2	0.97	0.97
PLEKHG2	0.97	0.92
PLXNA3	0.97	0.93
KDM6B	0.95	0.93
GTF2IRD1	0.95	0.89
CELSR3	0.94	0.84
AD000671.1	0.94	0.89
CASP2	0.94	0.85
ZNF646	0.94	0.89

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
C5orf53	-0.69	-0.81
FBXO2	-0.67	-0.65
HLA-F	-0.67	-0.69
ACOT13	-0.66	-0.77
ALDOC	-0.66	-0.64
ACYP2	-0.65	-0.73
S100B	-0.65	-0.77
AIFM3	-0.65	-0.63
CA4	-0.65	-0.76
LDHD	-0.65	-0.61

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0005515	protein binding	IEA		-
GO:0005516	calmodulin binding	IEA		-
GO:0005524	ATP binding	IEA		-
GO:0004385	guanylate kinase activity	TAS		9660868
GO:0004674	protein serine/threonine kinase activity	IEA		-
GO:0016740	transferase activity	IEA		-
GO:0016301	kinase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007155	cell adhesion	TAS		9660868
GO:0006468	protein amino acid phosphorylation	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-
GO:0005737	cytoplasm	IEA		-
GO:0005886	plasma membrane	TAS		9660868
GO:0015629	actin cytoskeleton	TAS		9660868

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
APBA1	D9S411E \| MINT1 \| X11 \| X11A \| X11ALPHA	amyloid beta (A4) precursor protein-binding, family A, member 1	X11-ALPHA interacts with Lin-2.	BIND	9822620
APBA1	D9S411E \| MINT1 \| X11 \| X11A \| X11ALPHA	amyloid beta (A4) precursor protein-binding, family A, member 1	-	HPRD,BioGRID	9753324 \|9822620 \|9952408\|9822620 \|9952408
ATP2B4	ATP2B2 \| DKFZp686G08106 \| DKFZp686M088 \| MXRA1 \| PMCA4 \| PMCA4b \| PMCA4x	ATPase, Ca++ transporting, plasma membrane 4	-	HPRD,BioGRID	12511555
C16orf70	C16orf6 \| FLJ12076 \| LIN10 \| lin-10	chromosome 16 open reading frame 70	Reconstituted Complex	BioGRID	9822620
CACNA1B	BIII \| CACNL1A5 \| CACNN \| Cav2.2	calcium channel, voltage-dependent, N type, alpha 1B subunit	The SH3 domain of CASK interacts with the carboxy-terminal proline-rich region (PRR) of Ca-alpha-1B.	BIND	10455105
CADM1	BL2 \| DKFZp686F1789 \| IGSF4 \| IGSF4A \| MGC149785 \| MGC51880 \| NECL2 \| Necl-2 \| RA175 \| ST17 \| SYNCAM \| TSLC1 \| sTSLC-1 \| sgIGSF \| synCAM1	cell adhesion molecule 1	-	HPRD,BioGRID	12202822
CASKIN1	ANKS5A	CASK interacting protein 1	-	HPRD	12040031
CD2AP	CMS \| DKFZp586H0519	CD2-associated protein	Reconstituted Complex	BioGRID	15331416
CNTNAP2	AUTS15 \| CASPR2 \| CDFE \| DKFZp781D1846 \| NRXN4	contactin associated protein-like 2	-	HPRD,BioGRID	12093160
CNTNAP4	CASPR4 \| KIAA1763	contactin associated protein-like 4	-	HPRD,BioGRID	12093160
DFNB31	CIP98 \| DKFZp434N014 \| KIAA1526 \| RP11-9M16.1 \| USH2D \| WHRN \| WI	deafness, autosomal recessive 31	-	HPRD,BioGRID	12641734
DLG1	DKFZp761P0818 \| DKFZp781B0426 \| DLGH1 \| SAP97 \| dJ1061C18.1.1 \| hdlg	discs, large homolog 1 (Drosophila)	Affinity Capture-Western in vitro in vivo Reconstituted Complex Two-hybrid	BioGRID	10993877 \|12151521 \|12351654 \|14960569
DLG1	DKFZp761P0818 \| DKFZp781B0426 \| DLGH1 \| SAP97 \| dJ1061C18.1.1 \| hdlg	discs, large homolog 1 (Drosophila)	CASK interacts with DLG1 (SAP97).	BIND	15729360
DLG1	DKFZp761P0818 \| DKFZp781B0426 \| DLGH1 \| SAP97 \| dJ1061C18.1.1 \| hdlg	discs, large homolog 1 (Drosophila)	-	HPRD	10993877 \|12351654
DLG4	FLJ97752 \| FLJ98574 \| PSD95 \| SAP90	discs, large homolog 4 (Drosophila)	-	HPRD,BioGRID	12151521
EPB41	4.1R \| EL1 \| HE	erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked)	-	HPRD,BioGRID	9660868
F11R	CD321 \| JAM \| JAM-1 \| JAM-A \| JAM1 \| JAMA \| JCAM \| KAT \| PAM-1	F11 receptor	-	HPRD,BioGRID	11120739
FCHSD2	KIAA0769 \| NWK \| SH3MD3	FCH and double SH3 domains 2	-	HPRD,BioGRID	14627983
GRIK2	EAA4 \| GLR6 \| GLUK6 \| GLUR6 \| MGC74427 \| MRT6	glutamate receptor, ionotropic, kainate 2	-	HPRD	12151522
ID1	ID \| bHLHb24	inhibitor of DNA binding 1, dominant negative helix-loop-helix protein	CASK interacts with Id1.	BIND	15694377
ID1	ID \| bHLHb24	inhibitor of DNA binding 1, dominant negative helix-loop-helix protein	CASK interacts with Id1'.	BIND	15694377
ID1	ID \| bHLHb24	inhibitor of DNA binding 1, dominant negative helix-loop-helix protein	Reconstituted Complex Two-hybrid	BioGRID	15694377
KCNJ12	FLJ14167 \| IRK2 \| KCNJN1 \| Kir2.2 \| Kir2.2v \| hIRK \| hIRK1 \| hkir2.2x \| kcnj12x	potassium inwardly-rectifying channel, subfamily J, member 12	-	HPRD,BioGRID	14960569 \|15024025
KCNJ4	HIR \| HIRK2 \| HRK1 \| IRK3 \| Kir2.3 \| MGC142066 \| MGC142068	potassium inwardly-rectifying channel, subfamily J, member 4	-	HPRD	11742811
KCNJ4	HIR \| HIRK2 \| HRK1 \| IRK3 \| Kir2.3 \| MGC142066 \| MGC142068	potassium inwardly-rectifying channel, subfamily J, member 4	Affinity Capture-Western	BioGRID	14960569 \|15024025
LIN7A	LIN-7A \| LIN7 \| MALS-1 \| MGC148143 \| TIP-33 \| VELI1	lin-7 homolog A (C. elegans)	Affinity Capture-Western in vitro in vivo Reconstituted Complex	BioGRID	9753324 \|9822620 \|14960569
LIN7A	LIN-7A \| LIN7 \| MALS-1 \| MGC148143 \| TIP-33 \| VELI1	lin-7 homolog A (C. elegans)	-	HPRD	9753324\|9822620 \|9952408
LIN7B	LIN-7B \| MALS-2 \| MALS2 \| VELI2	lin-7 homolog B (C. elegans)	-	HPRD	11742811
LIN7B	LIN-7B \| MALS-2 \| MALS2 \| VELI2	lin-7 homolog B (C. elegans)	Affinity Capture-Western	BioGRID	14960569
LIN7C	FLJ11215 \| LIN-7-C \| LIN-7C \| MALS-3 \| MALS3 \| VELI3	lin-7 homolog C (C. elegans)	Affinity Capture-Western	BioGRID	14960569
NPHS1	CNF \| NPHN	nephrosis 1, congenital, Finnish type (nephrin)	Affinity Capture-MS Reconstituted Complex	BioGRID	15331416
NRXN1	DKFZp313P2036 \| FLJ35941 \| Hs.22998 \| KIAA0578	neurexin 1	-	HPRD,BioGRID	11036064
NRXN1	DKFZp313P2036 \| FLJ35941 \| Hs.22998 \| KIAA0578	neurexin 1	-	HPRD	8786425
NRXN2	FLJ40892 \| KIAA0921	neurexin 2	-	HPRD	8786425
NRXN3	KIAA0743 \| MGC176711	neurexin 3	-	HPRD,BioGRID	8786425
PARK2	AR-JP \| LPRS2 \| PDJ \| PRKN	Parkinson disease (autosomal recessive, juvenile) 2, parkin	-	HPRD,BioGRID	11679592
RAB3A	-	RAB3A, member RAS oncogene family	-	HPRD	11377421
RPH3A	KIAA0985	rabphilin 3A homolog (mouse)	-	HPRD,BioGRID	11377421
SDC1	CD138 \| SDC \| SYND1 \| syndecan	syndecan 1	-	HPRD,BioGRID	9660868
SDC2	HSPG \| HSPG1 \| SYND2	syndecan 2	-	HPRD,BioGRID	9660868
SDC3	N-syndecan \| SDCN \| SYND3	syndecan 3	-	HPRD	10460248
TANC1	KIAA1728 \| ROLSB \| TANC	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	-	HPRD	15673434
TBR1	MGC141978 \| TES-56	T-box, brain, 1	-	HPRD,BioGRID	10749215
TSPYL2	CDA1 \| CINAP \| CTCL \| DENTT \| HRIHFB2216 \| SE20-4	TSPY-like 2	Affinity Capture-Western Two-hybrid	BioGRID	15066269

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG TIGHT JUNCTION	134	86	All SZGR 2.0 genes in this pathway
PID SYNDECAN 1 PATHWAY	46	29	All SZGR 2.0 genes in this pathway
PID SYNDECAN 2 PATHWAY	33	27	All SZGR 2.0 genes in this pathway
PID SYNDECAN 3 PATHWAY	17	15	All SZGR 2.0 genes in this pathway
SENGUPTA NASOPHARYNGEAL CARCINOMA UP	294	178	All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS DN	352	225	All SZGR 2.0 genes in this pathway
WANG CLIM2 TARGETS UP	269	146	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP	501	327	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 12HR UP	162	116	All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER GRADES 1 2 UP	137	84	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN	1375	806	All SZGR 2.0 genes in this pathway
GOZGIT ESR1 TARGETS DN	781	465	All SZGR 2.0 genes in this pathway
HAHTOLA MYCOSIS FUNGOIDES SKIN UP	177	113	All SZGR 2.0 genes in this pathway
CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS UP	126	72	All SZGR 2.0 genes in this pathway
CHIARADONNA NEOPLASTIC TRANSFORMATION CDC25 UP	120	73	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA DN	394	258	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN	483	336	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
MANALO HYPOXIA UP	207	145	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA CD1 AND CD2 UP	89	51	All SZGR 2.0 genes in this pathway
WEIGEL OXIDATIVE STRESS RESPONSE	35	28	All SZGR 2.0 genes in this pathway
ULE SPLICING VIA NOVA2	43	38	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 14HR UP	156	101	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 10HR UP	101	69	All SZGR 2.0 genes in this pathway
WANG SMARCE1 TARGETS UP	280	183	All SZGR 2.0 genes in this pathway
RIGGINS TAMOXIFEN RESISTANCE DN	220	147	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER UP	973	570	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP	863	514	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN BONE DN	315	197	All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP	871	505	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA D DN	78	34	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS DN	366	257	All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS UP	491	316	All SZGR 2.0 genes in this pathway
SYED ESTRADIOL RESPONSE	19	15	All SZGR 2.0 genes in this pathway
PYEON CANCER HEAD AND NECK VS CERVICAL UP	193	95	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 30MIN UP	56	38	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 4HR UP	55	41	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA PRONEURAL	177	132	All SZGR 2.0 genes in this pathway
CHYLA CBFA2T3 TARGETS UP	387	225	All SZGR 2.0 genes in this pathway
KRIEG HYPOXIA NOT VIA KDM3A	770	480	All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS DN	784	464	All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM B	517	302	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-146	207	213	m8	hsa-miR-146a	UGAGAACUGAAUUCCAUGGGUU
miR-146	207	213	m8	hsa-miR-146b^brain	UGAGAACUGAAUUCCAUAGGCU
miR-196	98	105	1A,m8	hsa-miR-196a	UAGGUAGUUUCAUGUUGUUGG
miR-196	98	105	1A,m8	hsa-miR-196b	UAGGUAGUUUCCUGUUGUUGG
miR-369-3p	247	253	m8	hsa-miR-369-3p	AAUAAUACAUGGUUGAUCUUU
miR-370	76	82	m8	hsa-miR-370^brain	GCCUGCUGGGGUGGAACCUGG
miR-410	269	275	m8	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-495	57	63	1A	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-543	265	272	1A,m8	hsa-miR-543	AAACAUUCGCGGUGCACUUCU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: CASK