Gene Page: STK16
Summary ?
| GeneID | 8576 |
| Symbol | STK16 |
| Synonyms | KRCT|MPSK|PKL12|TSF1 |
| Description | serine/threonine kinase 16 |
| Reference | MIM:604719|HGNC:HGNC:11394|Ensembl:ENSG00000115661|HPRD:05281|Vega:OTTHUMG00000154520 |
| Gene type | protein-coding |
| Map location | 2q35 |
| Pascal p-value | 0.036 |
| Sherlock p-value | 3.407E-4 |
| Fetal beta | 0.52 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01016 | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00916 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0005515 | protein binding | IPI | 17353931 | |
| GO:0005524 | ATP binding | IEA | - | |
| GO:0004674 | protein serine/threonine kinase activity | TAS | 9712705 | |
| GO:0016740 | transferase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006461 | protein complex assembly | TAS | 9712705 | |
| GO:0006468 | protein amino acid phosphorylation | TAS | 9712705 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016020 | membrane | IEA | - |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| ADAMTSL4 | TSRC1 | ADAMTS-like 4 | Two-hybrid | BioGRID | 16189514 |
| CNTF | HCNTF | ciliary neurotrophic factor | Affinity Capture-MS | BioGRID | 17353931 |
| ELK1 | - | ELK1, member of ETS oncogene family | - | HPRD,BioGRID | 10947953 |
| EXT2 | SOTV | exostoses (multiple) 2 | Affinity Capture-MS | BioGRID | 17353931 |
| FLJ10213 | - | hypothetical protein FLJ10213 | Affinity Capture-MS | BioGRID | 17353931 |
| HNF4A | FLJ39654 | HNF4 | HNF4a7 | HNF4a8 | HNF4a9 | MODY | MODY1 | NR2A1 | NR2A21 | TCF | TCF14 | hepatocyte nuclear factor 4, alpha | Affinity Capture-MS | BioGRID | 17353931 |
| ICA1 | ICA69 | ICAp69 | islet cell autoantigen 1, 69kDa | Affinity Capture-MS | BioGRID | 17353931 |
| KCTD17 | FLJ12242 | FLJ98761 | potassium channel tetramerisation domain containing 17 | Two-hybrid | BioGRID | 16189514 |
| MBP | MGC99675 | myelin basic protein | - | HPRD | 10947953 |
| MKKS | BBS6 | HMCS | KMS | MKS | McKusick-Kaufman syndrome | Affinity Capture-MS | BioGRID | 17353931 |
| NAGK | GNK | HSA242910 | N-acetylglucosamine kinase | Affinity Capture-Western Reconstituted Complex Two-hybrid | BioGRID | 11741987 |
| PASK | DKFZp434O051 | DKFZp686P2031 | KIAA0135 | PASKIN | STK37 | PAS domain containing serine/threonine kinase | Affinity Capture-MS | BioGRID | 17353931 |
| ROCK2 | KIAA0619 | Rho-associated, coiled-coil containing protein kinase 2 | Affinity Capture-MS | BioGRID | 17353931 |
| RPIA | RPI | ribose 5-phosphate isomerase A | Two-hybrid | BioGRID | 16189514 |
| SNRK | DKFZp779A1866 | FLJ20224 | HSNFRK | KIAA0096 | SNF related kinase | Affinity Capture-MS | BioGRID | 17353931 |
| STK16 | FLJ39635 | KRCT | MPSK | PKL12 | TSF1 | serine/threonine kinase 16 | - | HPRD,BioGRID | 9712705 |10947953 |
| TGIF1 | HPE4 | MGC39747 | MGC5066 | TGIF | TGFB-induced factor homeobox 1 | Affinity Capture-MS | BioGRID | 17353931 |
| VHL | HRCA1 | RCA1 | VHL1 | von Hippel-Lindau tumor suppressor | Affinity Capture-MS | BioGRID | 17353931 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| HAMAI APOPTOSIS VIA TRAIL DN | 186 | 107 | All SZGR 2.0 genes in this pathway |
| LIEN BREAST CARCINOMA METAPLASTIC VS DUCTAL DN | 114 | 58 | All SZGR 2.0 genes in this pathway |
| MOOTHA PGC | 420 | 269 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-370 | 300 | 306 | 1A | hsa-miR-370brain | GCCUGCUGGGGUGGAACCUGG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.