Gene Page: DYNLL1

Summary
GeneID  8655
Symbol  DYNLL1
Synonyms  DLC1|DLC8|DNCL1|DNCLC1|LC8|LC8a|MGC126137|MGC126138|PIN|hdlc1
Description  dynein, light chain, LC8-type 1
See related  HGNC:15476|MIM:601562|Ensembl:ENSG00000088986|HPRD:03334|
Locus tag  -
Gene type  protein-coding
Map location  12q24.23
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.2404 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
TRIP40.900.89
WDR700.900.88
GART0.900.87
ELP20.890.87
WTAP0.890.87
KDM10.890.84
CDKN2AIP0.890.87
METAP20.890.87
CNOT20.890.84
ZFP1120.890.83
Top 10 negatively co-expressed genes
AF347015.27-0.74-0.84
MT-CO2-0.73-0.83
AF347015.33-0.72-0.82
AF347015.31-0.72-0.83
MT-CYB-0.72-0.83
AF347015.15-0.72-0.86
AF347015.8-0.72-0.84
HLA-F-0.70-0.74
TINAGL1-0.70-0.76
AF347015.2-0.69-0.83
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003777microtubule motor activityIEA-
GO:0005515protein bindingIPI14607844 |18579519 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007292female gamete generationTAS8628263 
GO:0008633activation of pro-apoptotic gene productsEXP14764673 
GO:0009653anatomical structure morphogenesisTAS8628263 
GO:0007017microtubule-based processIEA-
GO:0042326negative regulation of phosphorylationIDA18579519 
GO:0030036actin cytoskeleton organizationTAS8628263 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005829cytosolEXP12591950 
GO:0005868cytoplasmic dynein complexTAS8628263 
GO:0005874microtubuleIEA-
GO:0005737cytoplasmIDA8628263 
GO:0005886plasma membraneEXP12591950 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ACTBPS1TP5BP1actin, beta-HPRD14760703 
ACTC1ACTC | CMD1R | CMH11actin, alpha, cardiac muscle 1-HPRD14760703 
ACTG1ACT | ACTG | DFNA20 | DFNA26actin, gamma 1-HPRD14760703 
ALDOAALDA | MGC10942 | MGC17716 | MGC17767aldolase A, fructose-bisphosphate-HPRD14760703 
ASF1BCIA-II | FLJ10604ASF1 anti-silencing function 1 homolog B (S. cerevisiae)Affinity Capture-MSBioGRID17353931 
BCAS1AIBC1 | NABC1breast carcinoma amplified sequence 1DLC8 interacts with AIBC1. This interaction was modeled on a demonstrated interaction between DLC8 from an unspecified species and human AIBC1.BIND11148209 
Affinity Capture-MSBioGRID17353931 
BCL2Bcl-2B-cell CLL/lymphoma 2Affinity Capture-WesternBioGRID10198631 
BCL2L1BCL-XL/S | BCL2L | BCLX | Bcl-X | DKFZp781P2092 | bcl-xL | bcl-xSBCL2-like 1Affinity Capture-WesternBioGRID10198631 
BCL2L11BAM | BIM | BIM-alpha6 | BIM-beta6 | BIM-beta7 | BOD | BimEL | BimLBCL2-like 11 (apoptosis facilitator)-HPRD10198631 
Reconstituted ComplexBioGRID14561217 |15193260 
BMFFLJ00065Bcl2 modifying factorReconstituted ComplexBioGRID14561217 
C14orf1ERG28 | NET51chromosome 14 open reading frame 1Two-hybridBioGRID16169070 
CA2CA-II | CAII | Car2carbonic anhydrase II-HPRD14760703 
CACNB1CAB1 | CACNLB1 | CCHLB1 | MGC41896calcium channel, voltage-dependent, beta 1 subunit-HPRD14760703 
CS-citrate synthase-HPRD14760703 
DDX3XDBX | DDX14 | DDX3 | HLP2DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linkedAffinity Capture-MSBioGRID17353931 
DLG2DKFZp781D1854 | DKFZp781E0954 | FLJ37266 | MGC131811 | PSD-93discs, large homolog 2, chapsyn-110 (Drosophila)Affinity Capture-WesternBioGRID10844022 
DLG4FLJ97752 | FLJ98574 | PSD95 | SAP90discs, large homolog 4 (Drosophila)Affinity Capture-Western
Reconstituted Complex
BioGRID10844022 
-HPRD14760703 
DLGAP1DAP-1 | DAP-1-ALPHA | DAP-1-BETA | GKAP | MGC88156 | SAPAP1 | hGKAPdiscs, large (Drosophila) homolog-associated protein 1Affinity Capture-Western
Reconstituted Complex
Two-hybrid
BioGRID10844022 
DAP-1 interacts with DLC-1.BIND11122378 
DLC8 interacts with GKAP. This interaction was modeled on a demonstrated interaction between DLC8 from an unspecified species and human GKAP.BIND11148209 
DNAJB9DKFZp564F1862 | ERdj4 | MDG1 | MST049 | MSTP049DnaJ (Hsp40) homolog, subfamily B, member 9Two-hybridBioGRID16169070 
DNM2CMTDI1 | CMTDIB | DI-CMTB | DYN2 | DYNIIdynamin 2-HPRD14760703 
DNM3KIAA0820 | MGC70433dynamin 3-HPRD14760703 
DNMT1AIM | CXXC9 | DNMT | FLJ16293 | MCMT | MGC104992DNA (cytosine-5-)-methyltransferase 1-HPRD14760703 
DYNC1H1DHC1 | DHC1a | DKFZp686P2245 | DNCH1 | DNCL | DNECL | DYHC | Dnchc1 | HL-3 | KIAA0325 | p22dynein, cytoplasmic 1, heavy chain 1-HPRD14760703 
DYNC1I1DNCI1 | DNCIC1dynein, cytoplasmic 1, intermediate chain 1Two-hybridBioGRID12475239 
DYNC1I2DNCI2 | FLJ21089 | FLJ90842 | IC2 | MGC104199 | MGC111094 | MGC9324dynein, cytoplasmic 1, intermediate chain 2Affinity Capture-MSBioGRID17353931 
DYNLL1DLC1 | DLC8 | DNCL1 | DNCLC1 | LC8 | LC8a | MGC126137 | MGC126138 | PIN | hdlc1dynein, light chain, LC8-type 1LC8 interacts with itself to form a homodimer.BIND15117959 
Two-hybridBioGRID12475239 |16169070 
EEF1A1CCS-3 | CCS3 | EEF-1 | EEF1A | EF-Tu | EF1A | FLJ25721 | GRAF-1EF | HNGC:16303 | LENG7 | MGC102687 | MGC131894 | MGC16224 | PTI1 | eEF1A-1eukaryotic translation elongation factor 1 alpha 1Two-hybridBioGRID16169070 
GAPDHG3PD | GAPD | MGC88685glyceraldehyde-3-phosphate dehydrogenase-HPRD14760703 
GLUD1GDH | GDH1 | GLUD | MGC132003glutamate dehydrogenase 1-HPRD14760703 
GLULGLNS | GS | PIG43 | PIG59glutamate-ammonia ligase (glutamine synthetase)-HPRD14760703 
GPHNGEPH | GPH | GPHRYN | KIAA1385gephyrin-HPRD12097491 |14760703 
HIP1RFLJ14000 | FLJ27022 | HIP12 | HIP3 | ILWEQ | KIAA0655 | MGC47513huntingtin interacting protein 1 related-HPRD14760703 
LDHALDH-M | LDH1 | PIG19lactate dehydrogenase A-HPRD14760703 
MAP1BDKFZp686E1099 | DKFZp686F1345 | FLJ38954 | FUTSCH | MAP5microtubule-associated protein 1B-HPRD14760703 
MARK3CTAK1 | KP78 | PAR1AMAP/microtubule affinity-regulating kinase 3-HPRD14760703 
MAST2FLJ39200 | KIAA0807 | MAST205 | MTSSK | RP4-533D7.1microtubule associated serine/threonine kinase 2-HPRD14760703 
ME2-malic enzyme 2, NAD(+)-dependent, mitochondrial-HPRD14760703 
MTA1-metastasis associated 1-HPRD14760703 
MTRFLJ33168 | FLJ43216 | FLJ45386 | MS5-methyltetrahydrofolate-homocysteine methyltransferase-HPRD14760703 
MYO10FLJ10639 | FLJ21066 | FLJ22268 | FLJ43256 | KIAA0799 | MGC131988myosin X-HPRD14760703 
MYO5AGS1 | MYH12 | MYO5 | MYR12myosin VA (heavy chain 12, myoxin)-HPRD,BioGRID10844022 
DLC8 interacts with Myosin V. This interaction was modeled on a demonstrated interaction between DLC8 from an unspecified species and human Myosin V.BIND11148209 
NDUFA4L2FLJ26118 | NUOMSNADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2Two-hybridBioGRID16169070 
NEK6SID6-1512NIMA (never in mitosis gene a)-related kinase 6Affinity Capture-MSBioGRID17353931 
NFKBIAIKBA | MAD-3 | NFKBInuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha-HPRD,BioGRID9372968 
I-kappa-B-alpha interacts with Dlc-1.BIND9372968 
NOS1IHPS1 | NOS | nNOSnitric oxide synthase 1 (neuronal)-HPRD8864115 
NRF1ALPHA-PALnuclear respiratory factor 1Affinity Capture-Western
Reconstituted Complex
BioGRID11069771 
NTRK2GP145-TrkB | TRKBneurotrophic tyrosine kinase, receptor, type 2-HPRD,BioGRID11157096 
PABPC1PAB1 | PABP | PABP1 | PABPC2 | PABPL1poly(A) binding protein, cytoplasmic 1Affinity Capture-MSBioGRID17353931 
PAK1MGC130000 | MGC130001 | PAKalphap21 protein (Cdc42/Rac)-activated kinase 1Affinity Capture-Western
Biochemical Activity
Reconstituted Complex
Two-hybrid
BioGRID15193260 
PAN2FLJ39360 | KIAA0710 | USP52 | hPAN2PAN2 polyA specific ribonuclease subunit homolog (S. cerevisiae)DLC8 interacts with KIAA0710. This interaction was modeled on a demonstrated interaction between DLC8 from an unspecified species and human KIAA0710.BIND11148209 
PARD3ASIP | Baz | Bazooka | FLJ21015 | PAR3 | PAR3alpha | PARD3A | SE2-5L16 | SE2-5LT1 | SE2-5T2par-3 partitioning defective 3 homolog (C. elegans)-HPRD14760703 
PFKMGSD7 | MGC8699 | PFK-1 | PFK-M | PFKXphosphofructokinase, muscle-HPRD14760703 
PFKPFLJ40226 | PFK-C | PFKFphosphofructokinase, platelet-HPRD14760703 
PKIAPRKACN1protein kinase (cAMP-dependent, catalytic) inhibitor alphaPIN interacts with PKIA.BIND11978406 
PKIBFLJ23817 | PRKACN2protein kinase (cAMP-dependent, catalytic) inhibitor betaPIN interacts with PKIB.BIND11978406 
PKIGMGC126458 | MGC126459protein kinase (cAMP-dependent, catalytic) inhibitor gammaPIN interacts with PKIG.BIND11978406 
POLHFLJ16395 | FLJ21978 | RAD30 | RAD30A | XP-V | XPVpolymerase (DNA directed), eta-HPRD14760703 
RAB4AHRES-1/RAB4 | RAB4RAB4A, member RAS oncogene family-HPRD,BioGRID11243854 
RGS2G0S8regulator of G-protein signaling 2, 24kDaTwo-hybridBioGRID16169070 
SHANK2CORTBP1 | CTTNBP1 | ProSAP1 | SHANK | SPANK-3SH3 and multiple ankyrin repeat domains 2Affinity Capture-WesternBioGRID10844022 
SHROOM3APXL3 | KIAA1481 | MSTP013 | SHRM | ShrmLshroom family member 3-HPRD14760703 
SLC25A10DICsolute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10DIC interacts with LC8.BIND15117959 
SNCGBCSG1 | SRsynuclein, gamma (breast cancer-specific protein 1)Affinity Capture-MSBioGRID17353931 
THAP8FLJ32891THAP domain containing 8Two-hybridBioGRID16169070 
TP53BP153BP1 | FLJ41424 | MGC138366 | p202tumor protein p53 binding protein 1Affinity Capture-Western
Protein-peptide
Two-hybrid
BioGRID15611139 
TRAF3IP3DJ434O14.3 | FLJ44151 | MGC117354 | MGC163289 | T3JAMTRAF3 interacting protein 3Affinity Capture-MSBioGRID18782753 
TUBA3CTUBA2 | bA408E5.3tubulin, alpha 3c-HPRD14760703 
TUBB2CTUBB2tubulin, beta 2C-HPRD14760703 
TXNDC17MGC14353 | TRP14 | TXNL5thioredoxin domain containing 17-HPRD,BioGRID14607843 
VIMFLJ36605vimentin-HPRD14760703 
ZHX1-zinc fingers and homeoboxes 1Two-hybridBioGRID16169070 
ZNF354AEZNF | HKL1 | KID-1 | KID1 | TCF17zinc finger protein 354A-HPRD14760703 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-32669751Ahsa-miR-326CCUCUGGGCCCUUCCUCCAG
miR-486134140m8hsa-miR-486UCCUGUACUGAGCUGCCCCGAG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.