Gene Page: WISP1

Summary
GeneID  8840
Symbol  WISP1
Synonyms  CCN4|WISP1c|WISP1i|WISP1tc
Description  WNT1 inducible signaling pathway protein 1
See related  HGNC:12769|MIM:603398|Ensembl:ENSG00000104415|HPRD:16019|
Locus tag  -
Gene type  protein-coding
Map location  8q24.1-q24.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 1.402 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI17353931 
GO:0005520insulin-like growth factor bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0001558regulation of cell growthIEA-
GO:0007155cell adhesionIEA-
GO:0016055Wnt receptor signaling pathwayIEA-
GO:0007267cell-cell signalingTAS9843955 
GO:0007165signal transductionTAS9843955 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionIEA-
GO:0005625soluble fractionTAS9843955 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
BGNDSPG1 | PG-S1 | PGI | SLRR1Abiglycan-HPRD11598131 
DCNCSCD | DSPG2 | PG40 | PGII | PGS2 | SLRR1Bdecorin-HPRD11598131 
UGCGL1FLJ23671 | FLJ23796 | HUGT1UDP-glucose ceramide glucosyltransferase-like 1Affinity Capture-MSBioGRID17353931 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-15/16/195/424/497155161m8hsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.