Gene Page: CCNC

Summary
GeneID  892
Symbol  CCNC
Synonyms  CycC
Description  cyclin C
See related  HGNC:1581|MIM:123838|Ensembl:ENSG00000112237|HPRD:00456|
Locus tag  RP1-199J3.1
Gene type  protein-coding
Map location  6q21
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI7568034 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0006350transcriptionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CDK3-cyclin-dependent kinase 3Cyclin C interacts with Cdk3.BIND15084261 
CDK8K35 | MGC126074 | MGC126075cyclin-dependent kinase 8-HPRD7568034 |11416138 
Affinity Capture-Western
Co-fractionation
in vitro
in vivo
BioGRID7568034 |9150135 
|9710619 |11416138 
CREBBPCBP | KAT3A | RSTSCREB binding proteinCo-fractionationBioGRID9710619 
MCM2BM28 | CCNL1 | CDCL1 | D3S3194 | KIAA0030 | MGC10606 | MITOTIN | cdc19minichromosome maintenance complex component 2Reconstituted ComplexBioGRID12392551 
MED10L6 | MGC5309 | NUT2 | TRG20mediator complex subunit 10Affinity Capture-MSBioGRID15175163 
MED19DT2P1G7 | LCMR1mediator complex subunit 19Affinity Capture-MSBioGRID15175163 
MED281500003D12Rik | DKFZp434N185 | EG1 | magicinmediator complex subunit 28Affinity Capture-MSBioGRID15175163 
MED29DKFZp434H247 | IXLmediator complex subunit 29Affinity Capture-MSBioGRID15175163 
-HPRD14576168 
POLR2AMGC75453 | POLR2 | POLRA | RPB1 | RPBh1 | RPO2 | RPOL2 | RpIILS | hRPB220 | hsRPB1polymerase (RNA) II (DNA directed) polypeptide A, 220kDa-HPRD,BioGRID9443979 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1333693761A,m8hsa-miR-133aUUGGUCCCCUUCAACCAGCUGU
hsa-miR-133bUUGGUCCCCUUCAACCAGCUA
miR-203.12442511A,m8hsa-miR-203UGAAAUGUUUAGGACCACUAG
miR-25/32/92/363/3676066131A,m8hsa-miR-25brainCAUUGCACUUGUCUCGGUCUGA
hsa-miR-32UAUUGCACAUUACUAAGUUGC
hsa-miR-92UAUUGCACUUGUCCCGGCCUG
hsa-miR-367AAUUGCACUUUAGCAAUGGUGA
hsa-miR-92bSZUAUUGCACUCGUCCCGGCCUC
miR-5439549601Ahsa-miR-543AAACAUUCGCGGUGCACUUCU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.