Gene Page: ANGPTL1

Summary
GeneID  9068
Symbol  ANGPTL1
Synonyms  ANG3|ANGPT3|ARP1|AngY|KIAA0351|UNQ162|dJ595C2.2
Description  angiopoietin-like 1
See related  HGNC:489|MIM:603874|Ensembl:ENSG00000116194|HPRD:04851|
Locus tag  -
Gene type  protein-coding
Map location  1q25.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005102receptor bindingIEANeurotransmitter (GO term level: 4)-
GO:0005102receptor bindingTASNeurotransmitter (GO term level: 4)10025962 |10051567 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007165signal transductionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionIEA-
GO:0005615extracellular spaceIDA10025962 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
NR2F6EAR-2 | EAR2 | ERBAL2nuclear receptor subfamily 2, group F, member 6-HPRD10318855 
TEKCD202B | TIE-2 | TIE2 | VMCM | VMCM1TEK tyrosine kinase, endothelialTie2 interacts with Ang3. This interaction was modeled on a demonstrated interaction between human Tie2 and mouse Ang3.BIND15542434 
-HPRD10051567 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-3209189251A,m8hsa-miR-320AAAAGCUGGGUUGAGAGGGCGAA
miR-4962562621Ahsa-miR-496AUUACAUGGCCAAUCUC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.