Gene Page: CLDN2

Summary
GeneID  9075
Symbol  CLDN2
Synonyms  -
Description  claudin 2
See related  HGNC:2041|MIM:300520|Ensembl:ENSG00000165376|HPRD:06471|
Locus tag  RP1-75H8.2
Gene type  protein-coding
Map location  Xq22.3-q23
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005198structural molecule activityIEA-
GO:0042802identical protein bindingISS-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0016338calcium-independent cell-cell adhesionISS-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005923tight junctionISSBrain (GO term level: 10)-
GO:0016021integral to membraneIEA-
GO:0005886plasma membraneIEA-
GO:0030054cell junctionIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
KRTAP4-12KAP4.12 | KRTAP4.12keratin associated protein 4-12Two-hybridBioGRID16189514 
TJP1DKFZp686M05161 | MGC133289 | ZO-1tight junction protein 1 (zona occludens 1)-HPRD,BioGRID10601346 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-15/16/195/424/497106112m8hsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU
miR-2141081141Ahsa-miR-214brainACAGCAGGCACAGACAGGCAG
miR-331511m8hsa-miR-331brainGCCCCUGGGCCUAUCCUAGAA
miR-94904961Ahsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.