Gene Page: PCSK7

Summary
GeneID  9159
Symbol  PCSK7
Synonyms  LPC|PC7|PC8|SPC7
Description  proprotein convertase subtilisin/kexin type 7
See related  HGNC:8748|MIM:604872|Ensembl:ENSG00000160613|HPRD:05339|
Locus tag  -
Gene type  protein-coding
Map location  11q23-q24
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.006 
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004252serine-type endopeptidase activityIEAglutamate (GO term level: 7)-
GO:0008233peptidase activityIDA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006508proteolysisIEA-
GO:0016486peptide hormone processingNAS9341152 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005794Golgi apparatusIEA-
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
GO:0030173integral to Golgi membraneIDA9341152 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
HSPA5BIP | FLJ26106 | GRP78 | MIF2heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)-HPRD,BioGRID10964928 
PCSK7LPC | PC7 | PC8 | SPC7proprotein convertase subtilisin/kexin type 7-HPRD,BioGRID10964928 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-125/3517237301A,m8hsa-miR-125bbrainUCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrainUCCCUGAGACCCUUUAACCUGUG
miR-320894900m8hsa-miR-320AAAAGCUGGGUUGAGAGGGCGAA
miR-7706712m8hsa-miR-7SZUGGAAGACUAGUGAUUUUGUUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.