SZGR2

Summary ?

GeneID	9253
Symbol	NUMBL
Synonyms	CAG3A\|CTG3a\|NBL\|NUMB-R\|NUMBLIKE\|NUMBR\|TNRC23
Description	numb homolog (Drosophila)-like
Reference	MIM:604018\|HGNC:HGNC:8061\|Ensembl:ENSG00000105245\|HPRD:04931\|Vega:OTTHUMG00000182627
Gene type	protein-coding
Map location	19q13.2
Pascal p-value	0.644
Sherlock p-value	0.156
Fetal beta	-0.569
DMG	2 (# studies)
eGene	Meta
Support	STRUCTURAL PLASTICITY G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.humanPSD G2Cdb.humanPSP

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Nishioka_2013	Genome-wide DNA methylation analysis	The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls.	2
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	2
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Association	A combined odds ratio method (Sun et al. 2008), association studies	2	Link to SZGene
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 4
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0329

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg26933384	19	41188655	NUMBL	1.467E-4	0.434	0.031	DMG:Wockner_2014
cg13285447	19	41196734	NUMBL		-0.02	0.33	DMG:Nishioka_2013

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
TGIF2	0.91	0.60
TP53	0.91	0.75
CDK2	0.91	0.67
GLI3	0.90	0.52
MCM2	0.90	0.85
PTBP1	0.89	0.72
TEAD2	0.89	0.63
CELSR1	0.89	0.68
ITPRIP	0.88	0.57
SFRP1	0.88	0.73

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
C5orf53	-0.43	-0.71
HLA-F	-0.42	-0.71
FBXO2	-0.42	-0.61
PTH1R	-0.42	-0.70
LHPP	-0.41	-0.57
SLC16A11	-0.41	-0.65
ASPHD1	-0.41	-0.56
AIFM3	-0.40	-0.64
AF347015.27	-0.40	-0.76
AF347015.31	-0.40	-0.77

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IPI		16713569
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007409	axonogenesis	IEA	neuron, axon, neurite (GO term level: 12)	-
GO:0007405	neuroblast proliferation	IEA	neuron (GO term level: 8)	-
GO:0030900	forebrain development	IEA	Brain (GO term level: 8)	-
GO:0007399	nervous system development	TAS	neurite (GO term level: 5)	9303539
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005737	cytoplasm	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG NOTCH SIGNALING PATHWAY	47	35	All SZGR 2.0 genes in this pathway
LIU COMMON CANCER GENES	79	47	All SZGR 2.0 genes in this pathway
WEI MIR34A TARGETS	148	97	All SZGR 2.0 genes in this pathway
LIAO METASTASIS	539	324	All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION UP	195	138	All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK	1210	725	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D	658	397	All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF	516	308	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	626	632	1A	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-125/351	190	196	1A	hsa-miR-125b^brain	UCCCUGAGACCCUAACUUGUGA
miR-125/351	190	196	1A	hsa-miR-125a^brain	UCCCUGAGACCCUUUAACCUGUG
miR-142-3p	143	149	1A	hsa-miR-142-3p	UGUAGUGUUUCCUACUUUAUGGA
miR-203.1	221	227	1A	hsa-miR-203	UGAAAUGUUUAGGACCACUAG
miR-218	448	454	1A	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-34/449	226	232	m8	hsa-miR-34a^brain	UGGCAGUGUCUUAGCUGGUUGUU
				hsa-miR-34c	AGGCAGUGUAGUUAGCUGAUUGC
				hsa-miR-449	UGGCAGUGUAUUGUUAGCUGGU
				hsa-miR-449b	AGGCAGUGUAUUGUUAGCUGGC
				hsa-miR-34a^brain	UGGCAGUGUCUUAGCUGGUUGUU
				hsa-miR-34c	AGGCAGUGUAGUUAGCUGAUUGC
				hsa-miR-449	UGGCAGUGUAUUGUUAGCUGGU
				hsa-miR-449b	AGGCAGUGUAUUGUUAGCUGGC
miR-369-3p	741	748	1A,m8	hsa-miR-369-3p	AAUAAUACAUGGUUGAUCUUU
miR-374	742	748	m8	hsa-miR-374	UUAUAAUACAACCUGAUAAGUG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: NUMBL