Gene Page: SYTL4

Summary
GeneID  94121
Symbol  SYTL4
Synonyms  DKFZp451P0116|FLJ40960|SLP4
Description  synaptotagmin-like 4
See related  HGNC:15588|MIM:300723|Ensembl:ENSG00000102362|HPRD:06735|
Locus tag  RP11-524D16__A.2
Gene type  protein-coding
Map location  Xq21.33
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0042043neurexin bindingISSSynap (GO term level: 4)-
GO:0005543phospholipid bindingISS-
GO:0005215transporter activityIEA-
GO:0008270zinc ion bindingIEA-
GO:0017137Rab GTPase bindingIEA-
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006810transportIEA-
GO:0006886intracellular protein transportIEA-
GO:0006887exocytosisISS-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0008021synaptic vesicleIEASynap, Neurotransmitter (GO term level: 12)-
GO:0016020membraneIEA-
GO:0019897extrinsic to plasma membraneISS-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CCDC85BDIPAcoiled-coil domain containing 85BTwo-hybridBioGRID16189514 
INSILPR | IRDNinsulin-HPRD10497219 
RAB27AGS2 | HsT18676 | MGC117246 | RAB27 | RAMRAB27A, member RAS oncogene family-HPRD11773082|11865063 
Affinity Capture-Western
Reconstituted Complex
Two-hybrid
BioGRID11773082 |11865063 
|12101244 |12176990 
|12590134 
RAB27B-RAB27B, member RAS oncogene family-HPRD,BioGRID11956164 
RAB3A-RAB3A, member RAS oncogene family-HPRD,BioGRID11773082 
RAB8AMEL | RAB8RAB8A, member RAS oncogene family-HPRD,BioGRID11773082 
STX1AHPC-1 | STX1 | p35-1syntaxin 1A (brain)-HPRD,BioGRID12101244 
STXBP1EIEE4 | MUNC18-1 | UNC18 | hUNC18 | rbSec1syntaxin binding protein 1Affinity Capture-WesternBioGRID12590134 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-136683689m8hsa-miR-136ACUCCAUUUGUUUUGAUGAUGGA
miR-539152215281Ahsa-miR-539GGAGAAAUUAUCCUUGGUGUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.