Gene Page: GCC2
Summary ?
| GeneID | 9648 |
| Symbol | GCC2 |
| Synonyms | GCC185|RANBP2L4|REN53 |
| Description | GRIP and coiled-coil domain containing 2 |
| Reference | MIM:612711|HGNC:HGNC:23218|Ensembl:ENSG00000135968|HPRD:11001|Vega:OTTHUMG00000153214 |
| Gene type | protein-coding |
| Map location | 2q12.3 |
| Pascal p-value | 0.036 |
| eGene | Cerebellar Hemisphere Cerebellum Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.0004 | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00755 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs6754115 | chr2 | 109962343 | GCC2 | 9648 | 0.12 | cis |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| RPRD2 | 0.91 | 0.92 |
| EP300 | 0.91 | 0.94 |
| DIP2C | 0.90 | 0.93 |
| FOXJ2 | 0.90 | 0.91 |
| TGFBRAP1 | 0.90 | 0.92 |
| C11orf30 | 0.90 | 0.92 |
| CREBBP | 0.90 | 0.92 |
| SEC16A | 0.89 | 0.92 |
| CPSF7 | 0.89 | 0.91 |
| ARID1B | 0.89 | 0.92 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.31 | -0.70 | -0.80 |
| MT-CO2 | -0.69 | -0.80 |
| FXYD1 | -0.68 | -0.78 |
| HIGD1B | -0.67 | -0.79 |
| IFI27 | -0.66 | -0.75 |
| S100B | -0.65 | -0.74 |
| AF347015.21 | -0.65 | -0.83 |
| AF347015.27 | -0.65 | -0.75 |
| AF347015.33 | -0.65 | -0.72 |
| HSD17B14 | -0.65 | -0.72 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0042802 | identical protein binding | IPI | 18243103 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000139 | Golgi membrane | IEA | - | |
| GO:0005794 | Golgi apparatus | IEA | - | |
| GO:0005737 | cytoplasm | IEA | - | |
| GO:0016020 | membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| WANG ESOPHAGUS CANCER VS NORMAL UP | 121 | 72 | All SZGR 2.0 genes in this pathway |
| HAMAI APOPTOSIS VIA TRAIL UP | 584 | 356 | All SZGR 2.0 genes in this pathway |
| NUYTTEN NIPP1 TARGETS UP | 769 | 437 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT AND CANCER BOX4 DN | 32 | 22 | All SZGR 2.0 genes in this pathway |
| NING CHRONIC OBSTRUCTIVE PULMONARY DISEASE UP | 157 | 105 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RESPONSE TO TRABECTEDIN DN | 271 | 175 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
| NAKAMURA ADIPOGENESIS LATE UP | 104 | 67 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
| LIM MAMMARY STEM CELL DN | 428 | 246 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-128 | 1506 | 1512 | 1A | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
| hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
| miR-135 | 896 | 902 | m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
| hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
| miR-214 | 1354 | 1360 | 1A | hsa-miR-214brain | ACAGCAGGCACAGACAGGCAG |
| miR-27 | 1506 | 1513 | 1A,m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
| hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
| miR-29 | 994 | 1000 | m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
| hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
| hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.