Gene Page: KIAA0430
Summary ?
| GeneID | 9665 |
| Symbol | KIAA0430 |
| Synonyms | LKAP|MARF1|PPP1R34 |
| Description | KIAA0430 |
| Reference | MIM:614593|HGNC:HGNC:29562|Ensembl:ENSG00000166783|HPRD:13992|Vega:OTTHUMG00000129884 |
| Gene type | protein-coding |
| Map location | 16p13.11 |
| Pascal p-value | 0.036 |
| Sherlock p-value | 0.337 |
| Fetal beta | 0.826 |
| eGene | Myers' cis & trans |
| Support | Darnell FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CNV:YES | Copy number variation studies | Manual curation | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DNM:Guipponi_2014 | Whole Exome Sequencing analysis | 49 DNMs were identified by comparing the exome of 53 individuals with sporadic SCZ and of their non-affected parents | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01775 |
Section I. Genetics and epigenetics annotation
DNM table
| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| KIAA0430 | A | C | NM_001184998 | p.M114L | missense | 0.12 | 0.47 | Schizophrenia | DNM:Guipponi_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs9875049 | chr3 | 56457469 | KIAA0430 | 9665 | 0.19 | trans | ||
| rs4366501 | chr11 | 133380324 | KIAA0430 | 9665 | 2.313E-4 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0003723 | RNA binding | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005777 | peroxisome | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN | 634 | 384 | All SZGR 2.0 genes in this pathway |
| DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA DN | 320 | 184 | All SZGR 2.0 genes in this pathway |
| NAGASHIMA NRG1 SIGNALING DN | 58 | 35 | All SZGR 2.0 genes in this pathway |
| SHEN SMARCA2 TARGETS UP | 424 | 268 | All SZGR 2.0 genes in this pathway |
| TARTE PLASMA CELL VS B LYMPHOCYTE DN | 38 | 25 | All SZGR 2.0 genes in this pathway |
| PENG RAPAMYCIN RESPONSE UP | 203 | 130 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RESPONSE TO TRABECTEDIN | 50 | 32 | All SZGR 2.0 genes in this pathway |
| KAYO AGING MUSCLE DN | 123 | 76 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 24HR UP | 148 | 96 | All SZGR 2.0 genes in this pathway |
| ROME INSULIN TARGETS IN MUSCLE UP | 442 | 263 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
| PLASARI TGFB1 SIGNALING VIA NFIC 1HR DN | 106 | 77 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124/506 | 582 | 588 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| miR-133 | 2265 | 2272 | 1A,m8 | hsa-miR-133a | UUGGUCCCCUUCAACCAGCUGU |
| hsa-miR-133b | UUGGUCCCCUUCAACCAGCUA | ||||
| miR-193 | 1983 | 1989 | m8 | hsa-miR-193a | AACUGGCCUACAAAGUCCCAG |
| hsa-miR-193b | AACUGGCCCUCAAAGUCCCGCUUU | ||||
| miR-224 | 569 | 575 | m8 | hsa-miR-224 | CAAGUCACUAGUGGUUCCGUUUA |
| miR-25/32/92/363/367 | 1607 | 1613 | m8 | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
| hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
| hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
| hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
| hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
| miR-7 | 1291 | 1298 | 1A,m8 | hsa-miR-7SZ | UGGAAGACUAGUGAUUUUGUUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.