|
GeneID |
10107
|
Symbol |
TRIM10
|
Synonyms |
HERF1|MGC141979|RFB30|RNF9
|
Description |
tripartite motif-containing 10 |
See related |
HGNC:10072|MIM:605701|Ensembl:ENSG00000204613|HPRD:05752| |
Locus tag |
DAAP-200B17.4 |
Gene type |
protein-coding |
Map location |
6p21.3 |
|
|
|
Gene set name |
Method of gene set |
Evidence |
Info |
GSMA_I | genome scan meta-analysis | Psr: 0.033 | |
|
|
General Gene Expression (microarray) ? |
|
|
|
Gene Expression in Brain Regions (new) |
|
|
Top co-expressed genes in Brain Regions (new) |
|
Gene | Pearson's Correlation | Spearman's Correlation | | |
Top 10 positively co-expressed genes |
CREB3L1 | 0.69 | 0.73 | | |
SUOX | 0.69 | 0.65 | | |
ADCY2 | 0.68 | 0.70 | | |
CCDC3 | 0.68 | 0.72 | | |
CCKBR | 0.66 | 0.69 | | |
SERPINE2 | 0.65 | 0.67 | | |
ETV5 | 0.65 | 0.71 | | |
OLFML2B | 0.64 | 0.70 | | |
CHRM1 | 0.64 | 0.68 | | |
ZDHHC8 | 0.64 | 0.64 | | |
Top 10 negatively co-expressed genes | C21orf57 | -0.46 | -0.45 | | |
FAM159B | -0.45 | -0.50 | | |
EIF5B | -0.41 | -0.39 | | |
RP9P | -0.38 | -0.39 | | |
AL050337.1 | -0.38 | -0.28 | | |
AC011475.1 | -0.38 | -0.35 | | |
CWF19L2 | -0.38 | -0.33 | | |
AC098691.2 | -0.38 | -0.27 | | |
RBMX2 | -0.36 | -0.34 | | |
NSBP1 | -0.36 | -0.32 | | |
|
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|
GO:0005515 | protein binding | IEA | | - |
GO:0008270 | zinc ion binding | IEA | | - |
GO:0008270 | zinc ion binding | NAS | | - |
GO:0046872 | metal ion binding | IEA | | - |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
---|
GO:0030097 | hemopoiesis | NAS | | - |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
---|
GO:0005622 | intracellular | IEA | | - |
GO:0005622 | intracellular | NAS | | - |
GO:0005737 | cytoplasm | IEA | | - |
|
|
|
|
|
|
miR-7 | 104 | 110 | 1A | hsa-miR-7SZ | UGGAAGACUAGUGAUUUUGUUG |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|