Gene Page: SEMA6C

Summary
GeneID  10500
Symbol  SEMA6C
Synonyms  SEMAY|m-SemaY|m-SemaY2
Description  sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C
See related  HGNC:10740|MIM:609294|Ensembl:ENSG00000143434|HPRD:10220|
Locus tag  RP11-68I18.3
Gene type  protein-coding
Map location  1q21.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0235 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00814 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004872receptor activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007399nervous system developmentIEAneurite (GO term level: 5)-
GO:0007275multicellular organismal developmentIEA-
GO:0030154cell differentiationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
 
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
KEGG_AXON_GUIDANCE 129103All SZGR genes in this pathway
ZHOU_INFLAMMATORY_RESPONSE_LIVE_UP 485293All SZGR genes in this pathway
GINESTIER_BREAST_CANCER_ZNF217_AMPLIFIED_DN 335193All SZGR genes in this pathway
BOGNI_TREATMENT_RELATED_MYELOID_LEUKEMIA_UP 3019All SZGR genes in this pathway
ZHOU_INFLAMMATORY_RESPONSE_FIMA_UP 544308All SZGR genes in this pathway
ZHOU_INFLAMMATORY_RESPONSE_LPS_UP 431237All SZGR genes in this pathway
LE_EGR2_TARGETS_DN 10884All SZGR genes in this pathway
MARTENS_TRETINOIN_RESPONSE_UP 857456All SZGR genes in this pathway
WIERENGA_STAT5A_TARGETS_UP 217131All SZGR genes in this pathway
WIERENGA_STAT5A_TARGETS_GROUP1 13676All SZGR genes in this pathway
BRUINS_UVC_RESPONSE_EARLY_LATE 317190All SZGR genes in this pathway
NABA_ECM_AFFILIATED 17189All SZGR genes in this pathway
NABA_MATRISOME_ASSOCIATED 753411All SZGR genes in this pathway
NABA_MATRISOME 1028559All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124.12802871A,m8hsa-miR-124aUUAAGGCACGCGGUGAAUGCCA
miR-124/5062802861Ahsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.