Gene Page: SEMA6B

Summary
GeneID  10501
Symbol  SEMA6B
Synonyms  SEM-SEMA-Y|SEMA-VIB|SEMAN|semaZ
Description  sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B
See related  HGNC:10739|MIM:608873|Ensembl:ENSG00000167680|HPRD:12322|
Locus tag  -
Gene type  protein-coding
Map location  19p13.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004872receptor activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007399nervous system developmentIEAneurite (GO term level: 5)-
GO:0007275multicellular organismal developmentIEA-
GO:0030154cell differentiationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-193173231Ahsa-miR-19aUGUGCAAAUCUAUGCAAAACUGA
hsa-miR-19bUGUGCAAAUCCAUGCAAAACUGA
miR-2181541611A,m8hsa-miR-218brainUUGUGCUUGAUCUAACCAUGU
miR-24625631m8hsa-miR-24SZUGGCUCAGUUCAGCAGGAACAG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.