Gene Page: SOX30

Summary
GeneID  11063
Symbol  SOX30
Synonyms  -
Description  SRY (sex determining region Y)-box 30
See related  HGNC:30635|MIM:606698|Ensembl:ENSG00000039600|HPRD:09461|
Locus tag  -
Gene type  protein-coding
Map location  5q33
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0032 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00459 
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.01718 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003677DNA bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0006350transcriptionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005730nucleolusIDA18029348 
GO:0005737cytoplasmIDA18029348 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
BAMBINMABMP and activin membrane-bound inhibitor homolog (Xenopus laevis)Two-hybridBioGRID16189514 
NUDT3DIPP | DIPP1nudix (nucleoside diphosphate linked moiety X)-type motif 3Two-hybridBioGRID16189514 
TRAF2MGC:45012 | TRAP | TRAP3TNF receptor-associated factor 2Two-hybridBioGRID16189514 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-203.12935m8hsa-miR-203UGAAAUGUUUAGGACCACUAG
miR-3745045101Ahsa-miR-374UUAUAAUACAACCUGAUAAGUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.