Gene Page: CHP

Summary
GeneID  11261
Symbol  CHP
Synonyms  SLC9A1BP
Description  calcium binding protein P22
See related  MIM:606988|Ensembl:ENSG00000187446|HPRD:06101|
Locus tag  -
Gene type  protein-coding
Map location  15q13.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenic, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005509calcium ion bindingIEA-
GO:0015459potassium channel regulator activityTAS8901634 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006813potassium ion transportTAS8901634 
GO:0007264small GTPase mediated signal transductionTAS8901634 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIEA-
GO:0043231intracellular membrane-bounded organelleIDA18029348 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
PRSS23MGC5107 | SIG13 | SPUVE | ZSIG13protease, serine, 23Two-hybridBioGRID16169070 
SLC9A1APNH | FLJ42224 | NHE1solute carrier family 9 (sodium/hydrogen exchanger), member 1Affinity Capture-Western
Far Western
Reconstituted Complex
BioGRID8901634 |11350981 
|12576672 
-HPRD8901634|12576672 
SLC9A2NHE2solute carrier family 9 (sodium/hydrogen exchanger), member 2Reconstituted ComplexBioGRID12576672 
-HPRD8901634|11350981 
SLC9A3MGC126718 | MGC126720 | NHE3solute carrier family 9 (sodium/hydrogen exchanger), member 3-HPRD,BioGRID8901634|12576672 
SLC9A4DKFZp313B031 | NHE4solute carrier family 9 (sodium/hydrogen exchanger), member 4Reconstituted ComplexBioGRID12576672 
SLC9A5NHE5solute carrier family 9 (sodium/hydrogen exchanger), member 5-HPRD,BioGRID12576672 
STK17BDRAK2serine/threonine kinase 17b-HPRD11481038 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124.124342440m8hsa-miR-124aUUAAGGCACGCGGUGAAUGCCA
miR-124/506243324401A,m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-141/200a108310891Ahsa-miR-141UAACACUGUCUGGUAAAGAUGG
hsa-miR-200aUAACACUGUCUGGUAACGAUGU
hsa-miR-141UAACACUGUCUGGUAAAGAUGG
hsa-miR-200aUAACACUGUCUGGUAACGAUGU
miR-203.110621068m8hsa-miR-203UGAAAUGUUUAGGACCACUAG
miR-204/211230423111A,m8hsa-miR-204brainUUCCCUUUGUCAUCCUAUGCCU
hsa-miR-211UUCCCUUUGUCAUCCUUCGCCU
miR-33021322138m8hsa-miR-330brainGCAAAGCACACGGCCUGCAGAGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.