Gene Page: ATXN2L

Summary
GeneID  11273
Symbol  ATXN2L
Synonyms  A2D|A2LG|A2LP|A2RP
Description  ataxin 2-like
See related  HGNC:31326|MIM:607931|Ensembl:ENSG00000168488|HPRD:06394|
Locus tag  -
Gene type  protein-coding
Map location  16p11
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.01775 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003674molecular_functionND-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0008150biological_processND-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005575cellular_componentND-
GO:0016020membraneIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
EPORMGC138358erythropoietin receptor-HPRD,BioGRID11784712 
MPLC-MPL | CD110 | MPLV | TPORmyeloproliferative leukemia virus oncogene-HPRD,BioGRID11784712 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-34251581A,m8hsa-miR-342brainUCUCACACAGAAAUCGCACCCGUC
miR-3775056m8hsa-miR-377AUCACACAAAGGCAACUUUUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.