Gene Page: GABARAPL2

Summary
GeneID  11345
Symbol  GABARAPL2
Synonyms  ATG8|GATE-16|GATE16|GEF-2|GEF2
Description  GABA(A) receptor-associated protein-like 2
See related  HGNC:13291|MIM:607452|Ensembl:ENSG00000034713|HPRD:16246|
Locus tag  -
Gene type  protein-coding
Map location  16q22.3-q24.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0089 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0050811GABA receptor bindingISSGABA (GO term level: 5)-
GO:0050811GABA receptor bindingNASGABA (GO term level: 5)11414770 
GO:0000149SNARE bindingISS10747018 
GO:0008017microtubule bindingNAS11414770 
GO:0051117ATPase bindingISS10747018 
GO:0048487beta-tubulin bindingISS-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006914autophagyNAS12507496 
GO:0006891intra-Golgi vesicle-mediated transportISS10747018 
GO:0015031protein transportIEA-
GO:0032781positive regulation of ATPase activityISS10747018 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0000139Golgi membraneISS10747018 |11414770 
GO:0000421autophagic vacuole membraneIDA15169837 
GO:0005794Golgi apparatusISS11414770 
GO:0005829cytosolISS11414770 
GO:0005622intracellularIDA11256614 
GO:0005624membrane fractionIDA12507496 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ATG3APG3 | APG3-LIKE | APG3L | DKFZp564M1178 | FLJ22125 | MGC15201 | PC3-96ATG3 autophagy related 3 homolog (S. cerevisiae)Affinity Capture-MSBioGRID17353931 
ATG4BAPG4B | AUTL1 | MGC1353ATG4 autophagy related 4 homolog B (S. cerevisiae)Affinity Capture-MS
Two-hybrid		BioGRID16169070 |17353931 
ATG7APG7-LIKE | APG7L | DKFZp434N0735 | GSA7ATG7 autophagy related 7 homolog (S. cerevisiae)-HPRD11890701 
BCL2L13BCL-RAMBO | MIL1BCL2-like 13 (apoptosis facilitator)Two-hybridBioGRID16189514 
CALCOCO2MGC17318 | NDP52calcium binding and coiled-coil domain 2Two-hybridBioGRID16189514 
EIF4G1DKFZp686A1451 | EIF4F | EIF4G | p220eukaryotic translation initiation factor 4 gamma, 1Affinity Capture-MSBioGRID17353931 
EZRCVIL | CVL | DKFZp762H157 | FLJ26216 | MGC1584 | VIL2ezrinAffinity Capture-MSBioGRID17353931 
GOSR1GOLIM2 | GOS-28 | GOS28 | GOS28/P28 | GS28 | P28golgi SNAP receptor complex member 1-HPRD10747018 
HBG1HBGA | HBGR | HSGGL1 | PRO2979hemoglobin, gamma AAffinity Capture-MSBioGRID17353931 
IRGQFKSG27 | FLJ12521 | FLJ38849 | FLJ42796 | FLJ46713 | IRGQ1immunity-related GTPase family, QAffinity Capture-MSBioGRID17353931 
LRPPRCCLONE-23970 | GP130 | LRP130 | LSFCleucine-rich PPR-motif containingAffinity Capture-MSBioGRID17353931 
MLXMAD7 | MXD7 | TCFL4 | bHLHd13MAX-like protein XTwo-hybridBioGRID16189514 
NEK9DKFZp434D0935 | MGC138306 | MGC16714 | NERCC | NERCC1 | Nek8NIMA (never in mitosis gene a)- related kinase 9Affinity Capture-MSBioGRID17353931 
NSFSKD2N-ethylmaleimide-sensitive factor-HPRD10747018 
RAP1AKREV-1 | KREV1 | RAP1 | SMGP21RAP1A, member of RAS oncogene familyBiochemical ActivityBioGRID12581858 
RAP2AK-REV | KREV | RAP2 | RbBP-30RAP2A, member of RAS oncogene familyBiochemical ActivityBioGRID12581858 
SQSTM1A170 | OSIL | PDB3 | ZIP3 | p60 | p62 | p62Bsequestosome 1Two-hybridBioGRID16189514 
TBC1D5KIAA0210TBC1 domain family, member 5Two-hybridBioGRID16189514 
TTBK1BDTK | KIAA1855 | RP3-330M21.4tau tubulin kinase 1Affinity Capture-MSBioGRID17353931 
UBA5FLJ23251 | FLJ23251UBA5 | THIFP1 | UBE1DC1ubiquitin-like modifier activating enzyme 5Two-hybridBioGRID16189514 
ULK1ATG1 | FLJ38455 | UNC51 | Unc51.1unc-51-like kinase 1 (C. elegans)-HPRD,BioGRID11146101 
VDAC1MGC111064 | PORIN | PORIN-31-HLvoltage-dependent anion channel 1Affinity Capture-MSBioGRID17353931 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-141/200a3433491Ahsa-miR-141UAACACUGUCUGGUAAAGAUGG
hsa-miR-200aUAACACUGUCUGGUAACGAUGU
miR-145112118m8hsa-miR-145GUCCAGUUUUCCCAGGAAUCCCUU
miR-200bc/4293583641Ahsa-miR-200bUAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200cUAAUACUGCCGGGUAAUGAUGG
hsa-miR-429UAAUACUGUCUGGUAAAACCGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.