Gene Page: TMEM200A

Summary
GeneID  114801
Symbol  TMEM200A
Synonyms  KIAA1913|TTMA|TTMC
Description  transmembrane protein 200A
See related  HGNC:21075|Ensembl:ENSG00000164484|HPRD:13901|
Locus tag  -
Gene type  protein-coding
Map location  6q23.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
 
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
SENGUPTA_NASOPHARYNGEAL_CARCINOMA_UP 294178All SZGR genes in this pathway
HORIUCHI_WTAP_TARGETS_UP 306188All SZGR genes in this pathway
TAKEDA_TARGETS_OF_NUP98_HOXA9_FUSION_10D_UP 194122All SZGR genes in this pathway
TAKEDA_TARGETS_OF_NUP98_HOXA9_FUSION_16D_UP 175108All SZGR genes in this pathway
SENESE_HDAC1_AND_HDAC2_TARGETS_UP 238144All SZGR genes in this pathway
SABATES_COLORECTAL_ADENOMA_DN 291176All SZGR genes in this pathway
JAATINEN_HEMATOPOIETIC_STEM_CELL_UP 316190All SZGR genes in this pathway
KOYAMA_SEMA3B_TARGETS_UP 292168All SZGR genes in this pathway
GEORGES_TARGETS_OF_MIR192_AND_MIR215 893528All SZGR genes in this pathway
RODWELL_AGING_KIDNEY_NO_BLOOD_UP 222139All SZGR genes in this pathway
IWANAGA_CARCINOGENESIS_BY_KRAS_DN 12081All SZGR genes in this pathway
GENTLES_LEUKEMIC_STEM_CELL_UP 2915All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-338105010561Ahsa-miR-338brainUCCAGCAUCAGUGAUUUUGUUGA
miR-9107310791Ahsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.