Gene Page: GRIN3A

Summary
GeneID  116443
Symbol  GRIN3A
Synonyms  FLJ45414|NMDAR-L|NR3A
Description  glutamate receptor, ionotropic, N-methyl-D-aspartate 3A
See related  HGNC:16767|MIM:606650|Ensembl:ENSG00000198785|HPRD:09443|
Locus tag  -
Gene type  protein-coding
Map location  9q31.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 8 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004972N-methyl-D-aspartate selective glutamate receptor activityIDAglutamate (GO term level: 8)17502428 
GO:0004972N-methyl-D-aspartate selective glutamate receptor activityISSglutamate (GO term level: 8)-
GO:0005234extracellular-glutamate-gated ion channel activityIEAglutamate (GO term level: 11)-
GO:0000287magnesium ion bindingIEA-
GO:0004872receptor activityIEA-
GO:0005509calcium ion bindingIEA-
GO:0005262calcium channel activityIEA-
GO:0005216ion channel activityIEA-
GO:0016594glycine bindingIDA17320117 
GO:0042802identical protein bindingIPI17997397 
GO:0051721protein phosphatase 2A bindingISS-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0016358dendrite developmentIEAneurite, dendrite (GO term level: 11)-
GO:0006816calcium ion transportISS-
GO:0006811ion transportIEA-
GO:0045471response to ethanolIDA17502428 |18445116 
GO:0060134prepulse inhibitionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0043025cell somaIDAaxon, dendrite (GO term level: 4)17658481 
GO:0043005neuron projectionIDAneuron, axon, neurite, dendrite (GO term level: 5)17658481 
GO:0017146N-methyl-D-aspartate selective glutamate receptor complexIDAglutamate, Synap (GO term level: 10)17997397 
GO:0045211postsynaptic membraneIEASynap, Neurotransmitter (GO term level: 5)-
GO:0045202synapseIDAneuron, Synap, Neurotransmitter, Glial (GO term level: 2)17658481 
GO:0016021integral to membraneNAS11880201 
GO:0005886plasma membraneIEA-
GO:0030054cell junctionIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
DLG4FLJ97752 | FLJ98574 | PSD95 | SAP90discs, large homolog 4 (Drosophila)in vitro
in vivo
Two-hybrid		BioGRID7569905 
GRIN1NMDA1 | NMDAR1 | NR1glutamate receptor, ionotropic, N-methyl D-aspartate 1Affinity Capture-WesternBioGRID12391275 
-HPRD9620802 |11160393 
|11588171 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-101901961Ahsa-miR-10aUACCCUGUAGAUCCGAAUUUGUG
hsa-miR-10bUACCCUGUAGAACCGAAUUUGU
miR-124/506817823m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-141/200a27162722m8hsa-miR-141UAACACUGUCUGGUAAAGAUGG
hsa-miR-200aUAACACUGUCUGGUAACGAUGU
miR-18623242330m8hsa-miR-186CAAAGAAUUCUCCUUUUGGGCUU
miR-33235423601Ahsa-miR-33GUGCAUUGUAGUUGCAUUG
hsa-miR-33bGUGCAUUGCUGUUGCAUUGCA
miR-37025682574m8hsa-miR-370brainGCCUGCUGGGGUGGAACCUGG
miR-421243424401Ahsa-miR-421GGCCUCAUUAAAUGUUUGUUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.