Gene Page: NANP

Summary
GeneID  140838
Symbol  NANP
Synonyms  C20orf147|HDHD4|MGC26833|dJ694B14.3
Description  N-acetylneuraminic acid phosphatase
See related  HGNC:16140|MIM:610763|Ensembl:ENSG00000170191|HPRD:17097|
Locus tag  -
Gene type  protein-coding
Map location  20p11.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 1.452 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000287magnesium ion bindingIEA-
GO:0016787hydrolase activityIEA-
GO:0008967phosphoglycolate phosphatase activityIEA-
GO:0050124N-acylneuraminate-9-phosphatase activityIDA16237198 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0005975carbohydrate metabolic processIEA-
GO:0008152metabolic processIEA-
GO:0046380N-acetylneuraminate biosynthetic processIDA16237198 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005575cellular_componentND-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-29685691m8hsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.